Tài liệu Nghiên cứu bệnh gumboro trên gà tại một số tỉnh đồng bằng sông cửu long tt tiếng anh

MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY SUMMARY OF DOCTOR THESIS Major: PATHOLOGY AND TREATMENT OF ANIMALS Major code: 62640102 PhD student: NGO PHU CUONG STUDY ON CHICKEN GUMBORO DISEASE IN SOME PROVINCES OF THE MEKONG DELTA Can Tho, 2019 THESIS WAS COMPLETELY CONDUCTED AT CAN THO UNIVERSITY Scientific Supervisor: Assoc. Prof. TRAN NGOC BICH Thesis was defened with the doctoral thesis examinination committee of Can Tho University. Meeting at: ………………………………, Can Tho University At …. … …. date …. month …. year …. Opponent 1: Opponent 2: Thesis can be found at the library: 1. Learning Resource Center, Can Tho University. 2. National Library of Vietnam. 1 LIST OF PUBLISHED SCIENTIFIC RESEARCH 1. Ngô Phú Cường và Trần Ngọc Bích, 2018. Epidemiological characteristics of chicken Gumboro disease in the Mekong Delta. ISSN 1859-2333. Can Tho University Journal of Science, 54(4B): 40 – 44. 2. Ngo Phu Cuong, Tran Ngoc Bich, and Tran Trung Tin, 2018. Some epidemiological characteristics of Gumboro disease in household chickens in 5 provinces of the Mekong Delta. ISSN 1859 – 4581. Science and Technology Journal of Agriculture and Rural Development, 21(1): 64 – 69. 3. Ngo Phu Cuong, Le Thi Kim Xuyen, Le Thanh Hoa and Tran Ngoc Bich, 2018. Analysis of characteristic molecular and pedigree of virulent Gumboro virus strains isolated in 20172018 in Ben Tre and Vinh Long. National Conference on Biotechnology 2018, 485-490. 4. National Conference on Biotechnology 2018, Ha Noi. 5. Workshop on Science and Technology of Veterinary Medicine 2018, Hai Duong. 2 Chapter 1: INTRODUCTION 1.1 The importance of thesis Gumboro disease has been one of the avian diseases causing the huge economic loss for the poultry industry in many provinces of Vietnam for a long time. Recently, Gumboro disease shows different mutant strains belonged to serotype I and II; among them, serotype I has a high virulence and pathogenicity (OIE, 2008). In Vietnam, Gumboro disease was officially found from the 1980s based on clinical symptoms, lesions, and epidemiology. Isolated IBDV with different genotypes and phenotypes coexist causing the disease progress complicated and difficult for achieving the effective treatment with vaccination (Nguyen Ba Thanh et al., 2007; Le Thi Kim Xuyen and Le Thanh Hoa, 2008; Ho Thi Viet Thu, 2012a). The research of Ho Thi Viet Thu (2012a) indicated that Gumboro disease usually outbreaks in the flocks without vaccination (70,0%), following by one-time vaccinated chicken (62,5%) and two-time vaccinated chicken (28,6%). In Vietnam, as well as in the Mekong Delta, Gumboro virus is diverse and complicated because of importing chicken breeds from many countries on the world. Moreover, IBDV with various genotypes and phenotypes makes the disease more severe and less effective in treatment by the vaccine. Therefore, the thesis named “Study on chicken Gumboro disease in some provinces of the Mekong Delta” was conducted. 1.2 The aim of research - Determining the prevalence of Gumboro virus in chickens raised in farms, households in the Mekong Delta. The related factors such as breeds, ages, vaccinated times, raising methods, death chickens… and some clinical symptoms in the suspicious infected flocks were included. - Determining the genetic characteristic of the Gumboro virus isolated in the Mekong Delta. Comparing the gene encoding VP2 region with the gene bank, commercial vaccine strains, and creating the genetic dendrogram of virus in the field. - Surveying the ratio of immune response and the difference in the immune response of three Gumboro vaccines in 2 chicken breeds (Ben Tre 3 “Noi” and Luong Phuong) 1.3 The meaning and practice of thesis Gumboro disease is an acute infectious disease caused by the virus in the poultry (mainly in chicken and turkey), considering as the classical disease of the poultry industry. There are many studies on this disease, virus, and preventive vaccines; however, this disease still outbreaks. Immunodeficiency significantly affects the preventive efficiency of many vaccination campaigns in chickens as well as increases the sensitivity of chickens to other opportunistic pathogens. Some evidence indicated that IBDV infected chicken flocks could become the host to transmitted other pathogenic viruses (Pham Hong Son et al., 2012; Ho Thi Viet Thu, 2012a). Recent reports reveal that IBDV has been one of the important pathogens causing the enormous economic loss for the poultry industry. IBDV isolated strains harbor different genotypes and phenotypes to lead the disease complex and difficult in the effective treatment with the vaccine (Nguyen Ba Thanh et al., 2007; Le Thi Kim Xuyen and Le Thanh Hoa, 2008; Ho Thi Viet Thu, 2012a). IBDV’effective prevention contributes to the general health of chicken flocks and decreases economic loss. Research for vaccine production based on the sequence of genetic nucleotides from IBDV isolated in the field has been conducted domestically and internationally. However, up to now, in the Mekong Delta, the information of decoding the VP2 region in Gumboro virus was still limited. Therefore, the nucleotide decryption of Gumboro virus isolated in the field was necessary for determining the pathogenic level, suitable vaccine selection to prevent Gumboro disease in chicken flocks, and increasing the economic efficiency of the poultry industry. 1.4 The new of thesis By collecting virus strains causing Gumboro disease in the field of some provinces in the Mekong Delta, comparing the modification of gene sequence, the antigen and pathogenicity, the resource and genetic relationship of virus strains, it helps us to select the suitable vaccine strains to prevent this disease effectively. On the other hand, it contributes to set 4 up a reliable scientific basis for developing the preventive strategy against the IBD disease in the Mekong Delta and saving the health of chicken flocks in Vietnam. Chapter 2: RESEARCH CONTENTS AND METHODS 2.1 Research contents, research time, and research places 2.1.1 Nội dung nghiên cứu Content 1: Study on the prevalence of chicken Gumboro disease in the Mekong Delta. Content 2: Study on the genetic characteristics of Gumboro virus isolated in the Mekong Delta. Content 3: Study on the immune response of three Gumboro vaccines selected from the result of Content 2 towards two chicken breeds (Ben Tre “Noi” and Luong Phuong). 2.1.2 Research time: from 10/2015 to 10/2018 2.1.3 Research places Research was carried out in 6 provinces of the Mekong Delta, including Ben Tre, Hau Giang, An Giang, Can Tho, Vinh Long, Tra Vinh. About the poultry farming, these provinces have developed both 2 raising methods: industrial chickens in big farms and household chickens. They are relatively representative of the poultry production in the Mekong Delta. For storage and examination of specimens, chicken sera: Department of Veterinary Medicine, College of Agriculture, Can Tho University. For running RT – PCR: Institute of Biotechnology – Vietnam Academy of Science and Technology, Ha Noi. For analyzing the sequence of VP2 genes from Gumboro virus in the field: Macrogen Company, Korea. For setting the layout of investigated experiments about the immune response of 3 Gumboro vaccines towards two chicken breeds (Ben Tre “Noi” and Luong Phuong): Dong Thap province. 2.2 Research facilities Tools: sample bags, 3 ml syringe, cotton, gloves, distilled tubes, tube racks, cool box, serum tube, micropipete, falcon tube, scissors, lancet. Other important facilities: refrigerator, -20oC freezer, -80oC freezer, vortex, balance, UV-VIS spectrometer, centrifuge, PCR thermocycler, electrophoresis box, Gel doc. Direct ELISA kit: IBDV Ag Test (originated from belgium) delivered from Thoi Dai Xanh company. Indirect ELISA kit: IBDV Ab Test, Thinh A company. 5 2.2.3 Research object 2.2.3.1 Content 1 - All chickens were raised in Ben Tre, Hau Giang, An Giang, Can Tho, Vinh Long, Tra Vinh. - No. of examined chicken flocks: 131 flocks. 2.2.3.2 Content 2 - Fabricius specimens were collect from suspicious chicken flocks infected with Gumboro disease (Content 1). - The nucleotides sequence of VP2 genes from Gumboro virus collected in Ben Tre, Hau Giang, An Giang, Can Tho, Vinh Long, Tra Vinh. 2.2.3.3 Content 3 Experimental chickens were raised at the households in Dong Thap. Ben Tre “Noi” chicks at a one-day age were bought from the local hatchery company. Luong Phuong chicks at a one-day age were bought from Nong Nghiep Tri Viet L.L.C. Chicks were vaccinated to prevent Marek disease before supplying for the farmers. Experimental chickens were fully captive to ensure the hygiene livestock environment, nutrition source, caring, and vaccination in regular. 2.3 Research method 2.3.1 Content 1 2.3.1.1 Method of the survey on the prevalence of chicken Gumboro disease in househols/farms Chicken breeds were mainly surveyed including hybrid “Noi”, Tau vang, Binh Dinh, Luong Phuong in 3 raising methods: free grazing, halfgrazing, and captivity (Table 2.1). Table 2.1: The number of examined chicken flocks in the Mekong Delta No. Province No. of examined flocks Ben Tre 1 26 2 Hau Giang 15 3 Can Thơ 14 4 Tra Vinh 19 5 Vinh Long 28 6 Total An Giang 29 131 6 2.3.1.2 Method of the survey on the characteristic symptoms and lesions in the suspicious infected chicken flocks Information collection: recording the related information about the chicken flocks using the questionnaire, when the disease was announced. Chickens infected Gumboro disease show the symptoms and lesions such as moodiness, withdrawing their beaks in the wings, falling to one side, lying down, half-closed eyes, stocking in the corner, picky or skip eating, drinking much, disorientation, white stools, loose or watery stools with blood, swollen or hemorrhagic Fabricius bursa, hemorrhagic in chest 2.3.1.3 Method of the Gumboro virus detection The suspicious infected chicken flocks with Gumboro disease were examined clinical symptoms and collected feces by using kit IBDV Ag Test (originated from Belgium) delivered by Thoi Dai Xanh company. 2.3.2 Content 2 2.3.2.1 Method of detection of VP2 gene from Gumboro virus isolated in the field - Step 1: Selection of samples - Step 2: Extraction of ARN from samples A pair of primer using for RT-PCR: forward GVF: 5’ CAAACGATCGCAGCGATGACAAACCTGCAAGAT 3’ and reverse GVR: 5’ GGCTTCAAAGACATAATTCGGGCC 3’. Amplification of gene at “hypervariable region” with molecular weight: 0.47 kb. - Step 3: Synthetic of c.DNA from ARN by using Themor kit - Step 4: Running PCR with c. DNA - Step 5: Electrophoresis PCR products on agarose gel 2%, at 75V, 50 min to check the amplification of gene. 2.3.2.2 Method of decryption of the nucleotide sequence of VP2 gene and determination of pathogenicity of Gumboro virus After detection of the VP2 gene from Gumboro virus isolated in the field, ta total of 10 virus samples, which were good quality, bright DNA bands, single bands (marked for each province) were selected to analyze the homogeneous gene. The sequence of VP2 gene was decoded in Macrogen Company, Korea. The nucleotide sequence of VP2 gene was compared by using GENDOC2.7 software. (http://www.nrbsc.org/gfx/gendoc/) 7 2.3.2.3 Method of comparison and creation of the genetic dendrogram from Gumboro virus isolated in the field with the gene bank and vaccine strains used in the Mekong Delta Access on the Gene bank to get the information of Gumboro virus strains which were announced in Vietnam and on the world, as well as in the Mekong Delta. Table 2.2: List of virus Gumboro strains and vaccine strains in the Gene bank used in this research Registered Isolated *Country Pathogenic No. Strain code code year group 1 GTN FJ842498 2003 Vietnam vv 2 GHUT12 FJ842493 2003 Vietnam vv 3 GPT FJ842495 2002 Vietnam vv 4 GT1ST DQ355815 2003 Vietnam vv 5 GTG25 DQ355818 2003 Vietnam vv 6 GTG FJ842499 2003 Vietnam vv 7 HuN11 LM651367 China vv 8 YS07 FJ695138 2007 China vv 9 9109 AY462027 2001 USA av 10 variantE AF133904 USA av 11 GLS AY368653 USA av 12 IM AY029166 USA av 13 STC D00499 USA av 14 Cu-1wt AF362747 Germany av 15 HN04 KC109816 2011 China at 16 D78 AF499929 Luxembourg at 17 HZ2 AF321054 1997 China at 18 JD1 AF321055 1997 China at 19 903-78 JQ411012 1978 Hungary at 20 IBD BLEN AY332560 USA av 21 BUR-706 EU544156 Brazil at 22 Cevac EU544158 Hungary at 23 Georgia KF573194 India at 24 Nobilis AJ586966 Netherland av vv: very virulent; av: antigenic variant; at: attenuated 8 During the survey, vaccine brandnames were frequently used including IBD Blen, Bur 706, Ceve Gumboro, Georgia, Nobilis; therefore, they are applied in this research: - Vaccine 1: IBD BLEN (MERIAL – USA) - Vaccine 2: BUR 706 (MERIAL – France) - Vaccine 3: Cevac Gumboro L (Hungary) - Vaccine 4: Georgia (India) - Vaccine 5: Nobilis (MSD – Netherland) 2.3.3 Content 3 2.3.3.1 Method of survey on the immune response of 3 Gumboro vaccines on Ben Tre “Noi” and Luong Phuong chickens a. Experimental henhouses The henhouses were the soil-floor with an area of 3.5 m2 prepared before stocking. The floor was covered with a layer of sand about 20 cm thick, 15 - 20 cm thick of rice husk on the paddled layer; the roof is made of nipa leaves. It were fenced with B40 net around, and covered with canvas to avoid drafts with a feeding light and feeder system for chickens. Cages, breeding equipment were disinfected before putting chickens into the experimental henhouses. b. Experimental arrangment The experiment were arranged in a completely random block with 4 experiments and 3 replicates (Table 2.3). Each experiment was 30 chickens/tratment. At 3 day-old, chicks were collected the heart blood to check the maternal antibodies; thus, a total of 60 chicks were used. Chickens were continuously raised in the experiments to collect the vein blood of wings. The total of chickens were used: 4 experiment x 2 breeds x 3 replicates = 720 chickens. Table 2.3: Experimental arrangement No. of chickens used in the No. of experiment (chickens) Breed replicates EX1 EX2 EX3 EX4 Ben Tre “Noi” 3 times 30 30 30 30 Luong Phuong 3 times 30 30 30 30 EX1: the control treatment (without vaccination); EX2: IBD BLEN (MERIAL – USA); EX3: Cevac Gumboro L (Hungary); EX4: Nobilis (MSD – Netherland) 9 2.3.3.2 Method of collecting blood to examine the anitibodies Table 2.4: Summary of vaccination times and collecting blood to examine the antibodies Experiment (chickens) Time Day-old (day) EX1 EX2 EX3 EX4 Vaccination First time 7 180 180 180 Second time 28 180 180 180 Blood collection Before vaccination 3 60 First time 21 60 60 60 60 Second time 42 60 60 60 60 EX1: Control; EX2: Vaccine IBD BLEN; EX3: Vaccine Cevac Gumboro L; EX4: Vaccine Nobilis The antibodies were examined by the direct ELISA assay of Gumboro virus. Indexx ELISA kit (USA) was supplied by Thinh A Com pany (Ho Chi Minh City). 2.4 Examined indexes 2.4.1 Content 1 - Characteristics of chicken flocks infected Gumboro disease: breed, raising method, age, vaccinated times... - The ratio of symptoms and lesions in Gumboro infected chickens. - The ratio of infected samples. - The ratio of death chickens due to Gumboro disease. 2.4.2 Content 2 - The sequence of nucleotide and amino acid of isolated Gumboro virus strains. - The homogenous level of the sequence of nucleotide and amino acid of Gumboro virus strains isolated in the filed and IBDV vaccine strains. - The homogenous level of the sequence of nucleotide and amino acid of Gumboro virus strains isolated in the filed and other strains in Vietnam and on the world (published on the Gene bank). - The genetic origin of Gumboro virus in the field. 2.4.3 Content 3 - The rate of immune response between 2 chicken breeds, used vaccine, and vaccination times. 10 - The difference of immune response between 2 chicken breeds, used vaccine, and vaccination times. 2.5 Data analysis The experimental data were analyzed by using the Excel software. The statistics and variance were analyzed by using Minitab 16. The comparison of the experimental avergaes were examined by Chi-Square and Tukey method of Minitab 16. Chapter 3: RESULTS AND DISCUSSIONS 3.1. Content 1: Survey on the prevalence of chicken Gumboro disease in some provinces of the Mekong Delta 3.1.1. Characteristics of chicken flocks infected Gumboro disease 3.1.1.1 The ratio of Gumboro infected chicken flocks among chicken breeds Table 3.1: The ratio of Gumboro infected chicken flocks among chicken breeds Suspicious Percentage Breed Infected flocks infected flocks (%) Hybrid “Noi” 52 15 28,8 Tau Vang 19 13 68,4 Binh Dinh 31 17 54,8 Luong Phuong 29 14 48,3 Total 131 59 45,0 P = 0,012 The suspicious Guboro infected flocks showed the symptoms: ruffled feathers, moodiness, drinking much, less or skip eating, white-stools diarrhea, stocking in the corner, increasing temperature before falling down. The feces were collected to examine the infected flocks by using the IBDV Ag Test kit (Thoi Dai Xanh Company). The results of Table 3.1 showed that the infected chicken flocks were respective in each chicken breeds as 15 flocks of hybrid “Noi”, 14 flocks of Luong Phuong, 13 flocks of Tau Vang, and 17 flocks of Binh Dinh. The total rate of infected chicken flocks was 45%. The ratio of infected chickens was significantly different among chicken breeds (P<0,05); the highest rate was Tau Vang chicken (68,4%), while the lowest ones was hybrid “Noi” chickens (28,8%). It indicates that the resistance against Gumboro disease depends on the genetic characteristic of chicken breeds that affect on the early immune response to IBDV. 11 3.1.1.2 The ratio of chicken Gumboro disease by raising methods Table 3.2: The ratio of chicken Gumboro disease by raising methods Method Free grazing Half-grazing Captivity Total No. of suspicious infected flocks 50 60 21 131 No. of infected flocks 14 33 12 59 Percentage (%) 28,0 55,0 57,1 45,0 P = 0,009 Table 3.2 showed that there was different significantly in the rate of Gumboro disease among raising methods; this disease occured primarily in free grazing or half-grazing chickens (57,1%, 55,0% respectively), and the lowest rate was in the captive chickens (28,0%) (P<0,05). The reason might be that the grazing method reduced stress due to the keeping (concentration, uncertain hygiene, lack of ventilation...); therefore, chickens were resistant well against the disease in comparison with captive chickens. 3.1.1.3 The ratio of chicken Gumboro disease by ages Table 3.3: The ratio of chicken Gumboro disease by ages No. of suspicious infected flocks No. of infected flocks Percentage (%) 12 - 21 days old 43 20 46,5 21 - 42 days old 54 31 57,4 > 42 days old 34 8 23,5 Total 131 59 45,0 Age P = 0,008 The results of Table 3.3 revealed that chickens at 21-42 days old were infected Gumboro diease at the highest rate (57,4%), following by chickens at 12 – 21 days old (46,5%), and chickens at over 42 days old (23,5%). This difference was significant in statistics (P<0,05). Thus, Gumboro disease mainly occurred in chickens at 21-42 days old 12 3.1.1.4 The ratio of Gumboro disease among vaccinated or unvaccinated chicken flocks Table 3.4: The ratio of infected chicken flocks by vaccination times Percentage Vaccinstion times Vaccinated flocks Infected flocks (%) Unvaccination 36 24 66,7 01 times 42 22 52,4 02 times 53 13 24,5 Total 131 59 45,0 P=0,001 Table 3.4 showed that unvaccinated flocks were infected this disease at the highest rate (66,7%), following by one-time vaccinated chickens (52,4%), and the least ones in two-time vaccinated chickens (24,5%). This comparison indicated that there was significantly different between unvaccinated chickens and one-time vaccinated chickens (P = 0,001). 3.1.2. The frequency of symptoms and lesions in chickens infected Gumboro disease Table 3.5: The frequency of the clinical characteristic symptoms in infected chickens (n=59) No. of samples Frequency Percentage (%) 59 59 100 59 59 100 59 56 94,9 Smeared feces on the cloaca 59 46 77,9 Dry skin of shanks 59 45 76,3 Self-pecking on the cloaca 59 21 35,6 Clinical symptoms Skip eating, ruffled feather, drinking much Moodiness, down head, and swooping wings Watery white-stools, green stools 13 Fig 3.1: Clinical symptoms of chickens infected Gumboro disease (A: wet and smeared feces on the cloaca; B: ruffled feather, down head) The clinical symptoms included the watery and white/green stools (94,9%), smeared feces on the cloaca (77,9%), dry skin of shanks (76,3%), and self-pecking on the cloaca (35,6%). By inspection of 59 chickens that were representative for 59 infected flocks, the gross lesions were recorded in Table 3.6. Table 3.6: The frequency of lesions in Gumboro infected chickens (n=59) The frequency Organ Lesions No. of samples Percentage (%) Fabricius bursa Swoolen, haemorrhage, atrophy 59 100,0 Thigh musscle Haemorrhage 45 76,2 Chest musscle Haemorrhage 32 54,2 Spleen Swoolen and/or necrosis 19 32,2 Kidney Swoolen 8 13,5 Intestine Haemorrhage 19 32,2 Between the proventriculus and gizzard Haemorrhage 26 44,1 14 Fig 3.2: The lesions of Gumboro disease in chickens (A: haemorrhage on thigh, B: Swoolen and pale kidney, C: Swoolen Fabricius bursa, accumulating external mucus; D: haemorrhage at the between of proventriculus and gizzard) 3.1.3. The ratio of chicken Gumboro disease in provinces of the Mekong Delta Table 3.7: The ratio of Gumboro infected chickens in the surveyed provinces Province No. of flocks No. of infected flocks Percentage (%) Ben Tre 26 11 42,3 Hau 15 9 60,0 Giang Can Tho 14 7 50,0 Tra Vinh 19 9 47,4 Vinh 28 12 42,8 Long An Giang 29 11 37,9 Total 131 59 45,0 P = 0,812 Of 131 chicken flocks, 59 flocks were infected Gumboro disease with the characteristic symptoms and lesions. Among provinces, chicken flocks in Hau Giang got the highest infected rate (60,0%), and the lowest ones was in An Giang (37,9%). 3.1.4 The ratio of death chickens due to Gumboro disease Table 3.8 exhibited that the death rate of chickens due to Gumboro disease was not much high (4,81%). However, there was a significant 15 difference among the surveyed provinces (P = 0,001); the highest rate of death chickens was in An Giang while the lowest ones was Ben Tre. Table 3.8: The ratio of death chickens due to Gumboro disease No. of No. of No. of Percentage of Province infected infected death death (%) flocks chickens chickens Ben Tre 26 11.200 365 3,25 Hau Giang 15 4.500 225 5,00 Can Tho 14 3.600 153 4,25 Tra Vinh 19 7.200 450 6,25 Vinh Long 28 9.200 455 4,95 An Giang 29 3.900 259 6,64 Total 131 39.600 1.907 4,81 P = 0,001 3.2. Content 2: Study on the genetic characteristics of Gumboro virus isolated in the Mekong Delta PCR assay was carried out to detect VP2 gene from Gumboro virus strains. The PCR products were obtained at 474 bp; and Fig 3.3 showed the DNA bands were quality, bright and single. Fig 3.3: The electrophoresis of PCR products from IBDV strains M: DNA marker 16 3.2.1 The nucleotide and amino acid sequence of IBDV isolated strains and vaccine strains Fig 3.4: A part of the chromatogram of the nucleotide sequence in the hypervariable segment of VP2 gene Fig 3.4 showed that the sequence was analyzed, and each color of the chromatogram presented for one kind of nucleotide. This chromatogram revealed the excellent quality of the sequence. This nucleotide sequence was compared with other published sequences on the Gene bank; it showed relatively homogenous. It means that all steps of RT-PCR (primers, thermocycling…) were corrected. Table 3.9: The variable location of nucleotide making the different amino acids among the examined samples Location of M1 M2 M3 M4 M5 M6 M7 M8 M9 M 10 nucleotide 724 A A A A A A A A A A 725 A A A A G A A A A A 726 C C C C C C C C C C 766 C C C C C C G G C C 767 G G G T C G T T T T 881 A G G A A A A A A A M1: Tra Vinh; M2: Hau Giang 1; M3: Hau Giang 2; M4: An Giang; M5: Can Tho 1; M6: Can Tho 2; M7: Ben Tre 1; M8: Ben Tre 2; M9: Vinh Long 1; M10: Vinh Long 2 The results indicated that there were 53 variable locations of nucleotide in comparison to 10 virus strains isolated in this research. Among these locations, 6 locations (724, 725, 726, 766, 767, 881) made the chances of amino acids at the critical locations (242, 256, 294) to transform the pathogenicity of virus samples in the field (Table 3.9). 17 Bable 3.10: Vị trí sai khác Nucleotide dẫn đến sai khác amino acid giữa các mẫu nghiên cứu và vaccine Variable location M1: Tra Vinh; M2: Hau Giang 1; M3: Hau Giang 2; M4: An Giang; M5: Can Tho 1; M6: Can Tho 2; M7: Ben Tre 1; M8: Ben Tre 2; M9: Vinh Long 1; M10: Vinh Long 2; VC1: IBD Blen; VC2: Bur 706; VC3: Cevac Gumboro L; VC4: Georgia; VC5: Nobilis The analyzed results of the nucleotide sequence were exhibited in Table 3.10. The samples isolated in the field (M1, M2, M3, M4, M6, M7, M8, M9, and M10) showed that the locations at 222, 242, 253, 256, 279, 294, 299 and 329 had the amino acid sequence of A-I-Q-I-D-A-I-S-A; it was not found in any the high pathogenic strains. The M5 sample belonged to the attenuated group with many varieties at 8 locations (A222P; I242V; Q253H; I256V; D279N; A284T; I294L; S299N) in comparison with the high pathogenic strains. The comparison of nucleotide sequences between vaccine strains and virus strains in the field indicated that there were a total of 81 different locations; however, the variety at 8 locations (724, 725, 726, 766, 767, 836, 837, and 881) changed the amino acid sequences (242, 256, 279, 294) to transform the pathogenicity. Thus, 3 of 5 important locations modified the pathogenicity were 242, 256, 294. Table 3.11: The location of modified amino acid in the epitope of VP2 gene from virus strains in the field and strains in the Gene bank No. Strain High pathogenicty 1 M1 2 M2 3 M3 4 M4 5 M6 6 M7 7 M8 Pathogenicity vv vv vv vv vv vv vv The location of transformed amino acid in the epitope 222 242 253 256 279 284 294 299 329 A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I N A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A 18 No. Strain Pathogenicity The location of transformed amino acid in the epitope 222 242 253 256 279 284 294 299 329 A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A A I Q I D A I S A T V Q V N A L N A N V Q V D A L N A N I Q V D A L N A P I Q V D A L N A P G Y L N T L T A S V Q I N A L N V 8 M9 vv 9 M10 vv 10 GTG vv 11 GTG25 vv 12 GTN vv 13 GT1ST vv 14 GPT vv 15 GHUT12 vv 16 YS07 vv 17 9109 vv 18 variantE vv 19 GLS vv 20 HuN11 vv Variant pathogenicity 21 STC av 22 IM av 23 Cu-1wt av 24 VC1 av 25 VC5 av Attenuated P V H V N T L N pathogenicity 26 M5 at P V N V N T L N 27 D78 at P V H V N T L N 28 HZ2 at P V H V N T L N 29 JD1 at P V H V N T L N 30 HN04 at P V H V N T L N 31 VC2 at P V H V N T L N 32 VC3 at P V H V N T L N 33 VC4 at P V H V N T L N M1: Tra Vinh; M2: Hau Giang 1; M3: Hau Giang 2; M4: An Giang; M5: Can Tho 1; M6: Can Tho 2; M7: Ben Tre 1; M8: Ben Tre 2; M9: Vinh Long 1; M10: Vinh Long 2; VC1: IBD Blen; VC2: Bur 706; VC3: Cevac Gumboro L; VC4: Georgia; VC5: Nobilis. vv: very virulent; av: antigenic variant; at: attenuated. IBDV strains isolated in Vinh Long, Tra Vinh, Ben Tre, Can Tho, Hau Giang, and An Giang were both belonged to the high pathogenicity group; it showed via the clinical symptoms and lesions. All the samples were collected from the unvaccinated chicken flocks with Gumboro disease. The samples collected in Can Tho having M5 strains were attenuated strains (Table 3.11) with unclear clinical symptoms and lesions. 19 R A A A A A A A A