Tài liệu Indian journal of research in pharmacy and biotechnology

Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) Editor B.Pragati Kumar, M.Pharm, Assistant Professor, Nimra College of Pharmacy Consulting editor Dr. S Duraivel, M.Pharm, Ph.D., Principal, Nimra College of Pharmacy Associate Editors Mr. Debjit Bowmick, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy Mr. Harish Gopinath, M.Pharm., (Ph.D) Assistant Professor, Nimra College of Pharmacy Dr. M. Janardhan, M.Pharm., Ph.D. Professor, Nimra College of Pharmacy Dr. A. Ravi Kumar, M.Pharm., Ph D. Professor, Bapatla College of Pharmacy Editorial Advisory Board Dr.Y.Narasimaha Reddy, M. Pharm., Ph D. Principal, University college of Pharmaceutical Sciences, Kakatiya University, Warangal. Dr.V.Gopal, M. Pharm., Ph D. Dr. Biresh Kumar Sarkar, Asstt.Director (Pharmacy), Kerala Dr. M.Umadevi, M.Sc. (Agri), Phd Principal, Mother Theresa Post Graduate & Research Institute of Health Sciences,Pondicherry-6 Research Associate, Tamil Nadu Agricultural University, Coimbatore Dr. J.Balasubramanium, M. Pharm., Ph D. Dr. V.Prabhakar Reddy, M. Pharm., Ph D. General Manager, FR&D R A Chem Pharma Ltd., Hyderabad Principal, Chaitanya College of Pharmacy Education & Research, Warangal Dr.P.Ram Reddy, M. Pharm., Ph D. Dr. S.D.Rajendran, M. Pharm., Ph D. Director, Pharmacovigilance, Medical Affairs, Sristek Consultancy Pvt. Ltd, Hyderabad General Manager, Formulation, Dr.Reddy’s Laboratory, Hyderabad IJRPB 1(6) www.ijrpb.com November-December 2013 INDIAN JOURNAL OF RESEARCH IN PHARMACY AND BIOTECHNOLOGY Instructions to Authors Manuscripts will be subjected to peer review process to determine their suitability for publication provided they fulfill the requirements of the journal as laid out in the instructions to authors. After the review, manuscripts will be returned for revision along with reviewer’s and/or editor’s comments. Don’t copy and paste the article content from internet or other sources like e-books etc. Authors are the sole responsible persons for the article, article content; results of the research conducted and copy right issues if any. The editor and the editorial board are not entitled to change the article content, results and diagrammatic representations which are given by authors. The article will be published only after getting the approved galley proof from the authors. Kindly follow the below guidelines for preparing the manuscript: 1. Prepare the manuscript in Times New Roman font using a font size of 12. There shall not be any decorative borders anywhere in the text including the title page. 2. Don’t leave any space between the paragraphs. 3. Divide the research article into a. Abstract Visit us at b. Introduction www.ijrpb.com c. Materials and Methods Contact us/ send your articles to: d. Results Email: [email protected] e. Discussion Phone no: 9490717845; 9704660406 f. conclusion g. References 4. References should include the following in the same order given below a) Author name followed by initials b) Title of the book/ if the reference is an article then title of the article c) Edition of the book/ if the reference is an article then Journal name d) Volume followed by issue of the journal e) Year of publication followed by page numbers 5. Download the author declaration form from the web site www.ijrpb.com, fill it and submit it after signing by corresponding and co-authors to IJRPB. You can send the filled in form by post or scanned attachment to [email protected]. 6. Keep in touch with the editor through mail or through phone for further clarifications as well as for timely publication of your article. Indian Journal of Research in Pharmacy and Biotechnology is a bimonthly journal, developed and published in collaboration with Nimra College of Pharmacy, Ibrahimpatnam, Vijayawada, Krishna District, Andhra Pradesh, India-521456 Printed at: F. No: 501, Parameswari Towers, Ibrahimpatnam, Vijayawada, India -521456 IJRPB 1(6) www.ijrpb.com November-December 2013 Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) S.No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Contents Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker Showkat Hussain Ganie, Deepak Yadav, Altaf Ahmad, Anis Chadhry, Mohd Asif Page No. 765-771 Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed release tablets in QbD environment V Malleswari Bai, M Prasada Rao, M Chandana, K Naga Harini, B Naga Deepthi, K Thirumala Devi1, P Lakashmana Rao, Vinay U rao and J Naga raja Development and validation of a stability indicating HPLC method for analysis of Altretamine in bulk drug and pharmaceutical formulations M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao A review of various analytical methods on Atrovastatin N.Delhiraj, P.Ashok,U.Ravikiran,P.Abhinandhana 772-777 A review on the use of Bleomycin-Cisplatin-Vinblastine combinations in therapy of testicular cancer Praveen D, Ranadheer Chowdary P Method development and validation for the simultaneous estimation of Ofloxacin and Tinidazole in bulk and pharmaceutical dosage form by reverse phase HPLC method Y.Bhargav, K Haritha Pavani, S Amareswari Evaluation of nephro protective activity of methanolic extract of seeds of Vitis vinifera against Rifampicin and carbon tetra chloride induced nephro toxicity in wistar rats Kalluru Bhargavi, N Deepa Ramani, Janarthan M, Duraivel S Method development and validation for the simultaneous estimation of Atazanavir and Ritonavir in tablet dosage form by RP-HPLC Nuli Vasavi, Afroz Patan Evaluation of anti arthritic activity of aqueous extract of Hibiscus Platinifolius in albino rats Marri Praveen, M.Janarthan Some H.R. methodology/ techniques for costs reduction in companies to improve profit M. Sarkar, B. K. Sarkar, M. D. Gora, S. C. Verma 793-796 Analytical method development and validation of Artesunate and Amodiaquine hydrochloride in tablet dosage form by RP-HPLC P RajaRao, Nanda Kishore Agarwal Analytical method development and validation for the simultaneous estimation of Rabeprazole sodium and Itopride hydrochloride in bulk and pharmaceutical dosage forms by RP-HPLC Syed Shaheda, Nanda Kishore Agarwal Formulation and evaluation of herbal anti-dandruff shampoo Anusha Potluri*, Harish. G, B. Pragathi Kumar, Dr. Durraivel 822-827 Analytical method development and validation for the simultaneous estimation of Paracetamol and Tapentadol by RP-HPLC in bulk and pharmaceutical dosage forms V.Praveen Kumar Reddy, Aneesha, D.Sindhura, M.Sravani, Thandava Krishna Reddy Protective role of methanolic extract of Polygonum glabrum willd against Cisplatin and Gentamycin induced nephrotoxicity in Albino rats Radha.B, Janarthan M, Durraivel S Analytical method development and validation for the simultaneous estimation of Rosuvastatin and Finofibate in tablet dosage form by reverse phase high performance liquid chromatography M. Sumalatha, K.Haritha Pavani A new development and validated RP-HPLC method for the assay and related substances of Itraconazole in capsule dosage form Sarvani Paruchuri, Haritha Pavani K Evalution of anti urolithiatic activity of aqueous extract of stem core of Musa paradisiaca againest ethylene glycol and ammonium chloride induced urolithiasis on wistar rats Thirumala K, Janarthan M, Firasat Ali M Preparation and characterization of bioadhesive vaginal gel of Propranolol hydrochloride Hardeep Singh Dhaliwal, Dhruba Sankar Goswami 840-845 Volume 1 Issue 6 www.ijrpb.com 778-785 786-792 797-802 803-807 808-814 815-818 819-821 828-834 835-839 846-849 850-856 857-865 866-868 869-874 November-December 2013 20 21 22 23 24 25 26 27 28 Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2320-3471 (Online) ISSN: 2321-5674 (Print) Topical herbal analgesic and anti arthritic (max-relief) versus Diclofenac in symptomatic treatment of osteoarthritis of the knee: a randomized controlled trial Md Q Azam, Abdallah A Al-Othman, Mir Sadat-Ali, Ahmed A Tantawy Analytical method development and validation for the estimation of Olmesartan medoxomil by RP-UPLC in bulk and pharmaceutical dosage forms Farhana Pattan, Haritha Pavani, Chandana N, Karimulla M Modern hygienic industrial canteen amenity: A change factor for healthy physical work environment of the work force in Indian industrial units TN Murty, GV Chalam, Md Aasif Siddique Ahmed Khan, T Abhinov and T Abhilash Design and development of Metformin hydrochloride Trilayered sustained release tablets Venkateswara Rao T, Bhadramma N, Raghukiran CVS and Madubabu K Amlodipine: the upcoming threat to Periodontist Sivaranjani, Vineet Kashyap, S.P.K.Kennedy Babu, Ajish Paul K, Study of the influence of Hydrophillic polymers and Citric acid on Bi-layered floating tablets of Diltiazem hydrochloride Venkateswara Rao T, Bhadramma N, Raghukiran CVS2 and Madubabu K3 Development and optimization of Diltiazem hydrochloride loaded microspheres by using different Eudragit polymers V. Kamalakkannan, K.S.G.Arul Kumaran Formulation, characterization and optimization of Methotrexate loaded sodium alginate chitosan Nanoparticles using 32 factorial design S.Daisy Chella Kumari, C.B.Tharani , N.Narayanan , C.Senthil Kumar Strategies in Dendritic architecture for drug delivery – An over review Pandurangan Dinesh Kumar, Palanirajan Vijayaraj Kumar, Govindaraj Saravanan Volume 1 Issue 6 www.ijrpb.com 875-880 881-885 886-892 893-897 898-900 901-907 908-914 915-921 922-934 November-December 2013 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker Showkat Hussain Ganie1, Deepak Yadav1, Altaf Ahmad2, Anis Chadhry1, Mohd Asif1* 1. Department of Ilmul-Advia, Faculty of Medicine, Jamia Hamdard, New Delhi-110062 India 2. Department of Botany, Faculty of Science, Jamia Hamdard, New Delhi-110062 *Corresponding author: Email: [email protected], Phone: 8860142069 ABSTRACT Nigella sativa, commonly known as kalongi is an important drug of traditional system of medicine, commonly used against cough, fever, abdominal disorders, skin infections, paralysis and jaundice. Because of increased demand and high price, there are chances that the herb could be adulterated in the trade by other related species. Therefore, a reliable authentication method is needed to facilitate identification of this genuine material from its adulterants. To carry out the work, the market samples were procured from the crude-drug markets of different geographical regions of India. The RAPD derived LAMP technique was employed for the characterization of different accessions of Kalongi. 19 primers were used of which one unique band, common in all accessions were eluted, cloned and sequenced. LAMP primers were designed and LAMP product formation was detected at 60°C.Out of 25 primers, 19 primers amplified a total of 524 reproducible, clear and scorable bands. One monomorphic RAPD fragment present in all the accessions, amplified by OPAA-09 primer, was developed into LAMP marker for identification of N. Sativa. The primers successfully amplified the genome of kalongi while as in negative control (Catharanthus roseus) there was no amplification. The LAMP markers developed in this study may provide guidance for the authentication of plant materials traded as Kalongi. Key words: Adulteration; Authentication; loop mediated isothermal amplification (LAMP); Molecular markers; kalongi; RAPD. 1. INTRODUCTION The traditional knowledge of herbal medicine is widespread- ranging from tribal folklore use to age-old practices and closely guarded recipes handed down from generation to generation, to highly evolved systems of medicine like Ayurveda, Unani and Siddha. These systems have served the humanity through the centuries and it is certain that they will continue to be in use for times to come. However, in the process of urbanization the contact with nature was cut off and, consequently, the knowledge about the identification of medicinal plants deteriorated to a great extent. Additionally, the crude drugs sold in the market are adulterated, sophisticated or substituted by quite unrelated plant materials. The adulteration of market samples is one of the greatest drawbacks in promotion of herbal products (Dubey, 2004). Plant samples in the market are stored under undesirable conditions over the years and often contain a mixture of other plant species (Khatoon, 1993), thus, adversely affecting their bio efficacy. The efficacy of many of the drugs has become suspect because of the adulterated, dried raw materials profusely available in the indigenous market (Anonymous, 1996). Very often the identity of market drugs is taken for granted without subjecting the plant material to stringent methods of botanical identification. This result in the loss of therapeutic potential of the preparations if the plant used is adulterated or substituted. It results in the production of misleading or overlapping data on IJRPB 1(6) www.ijrpb.com phytochemical, pharmacological, pharmacognostical and clinical aspects. Nigella sativa (Family: Ranunculaceae) is considered one of the most important medicinal herb used in various Indigenous System of Medicine. The plant cultivated almost all over India, is an annual herb with linear- lance late leaves. Pale blue flowers are solitary, fruit is capsule; seeds are black, flattened, angular and funnel shaped. Seeds of the herb are mostly used in medicine. Many formulations containing Kalongi as a single drug or in combination with other drugs are available in Indian market. The important Unani formulations using the drug are “Anquriya Kabir, Habe-e-Halteet, Roghan Kalan, Qairuti Arad Karsana, Mujun Nankhaw”. Traditionally the drug is used against cough, fever, abdominal disorders, skin infections, paralysis and jaundice (Paarakh, 2010). Seed oil is used as a local anaesthetic (Paarakh, 2010). As far as its pharmacological activities are concerned, the drug is hypoglycaemic, hypocholestermic (Bamosaet, 2002) and antioxidant (Kanter, 2003). Thymoquinone (constituent of seed oil extract) is antitumor, found to kill the pancreatic cancer cells and its derivatives are used in blood, skin and breast cancers (Paarakh, 2010). The aqueous decoction of kalonji revealed significant antibacterial potential against Staphylococcus aureus, Micrococcus roseus, Streptococcus mutans, Streptococcus morbillorium, Streptococcus sanguis, Streptococcus intermedius, November – December 2013 Page 765 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology Klebsiella ozaenae, Aeromonas hydrophila, and Streptococcus salivarius (Chaudhry and Tariq, 2008). Considering the medicinal importance of Kalongi, the authentication of this herb is highly mandatory. DNA fingerprinting techniques are very useful for correct identification of taxa. Among various DNA markers, loop-mediated isothermal amplification (LAMP) is convenient because the reaction could be conducted under isothermal conditions, thereby facilitating amplification and the results could be achieved in less than 1 hr. To the best of our knowledge, no attempt has been made to characterize this herb using molecular biology. To fill this gap, we employed LAMP markers to authenticate the said drug. For this, samples were collected from the crude drug dealers of North and West India. 2. MATERIALS ANDMETHODS 2.1. Plant material: The samples of N. Sativa were collected from crude drug dealers of Delhi, Kolkatta, Uttarakhand and Uttar Pradesh. Voucher specimens of these samples were prepared and kept in the Herbarium, Department of Botany, Hamdard University, New Delhi, 110062. The seeds are stored in seed bank, Department of Botany, Hamdard University, New Delhi, 110062. The identified specimens were compared with authenticated voucher specimens preserved in the herbarium of National Institute of Science and Information Resources (NISCAIR). The seeds were used for DNA isolation. 2.2. DNA Isolation: The modified CTAB protocol of Doyle and Doyle (1990) and purification kit (HiPurA, India) were used to extract DNA from the overnight soaked seeds. 2.2.1. Reagents and Solutions: CTAB extraction buffer (2M Sodium Chloride, 100mM TrisHCl (pH 8), 20 mM EDTA) 0.2% β-mercaptoethanol, Chloroform:Isoamylalcohol (24:1), absolute alcohol, 3M Potassium acetate, Isoamyl alcohol. All the chemicals chemical were of analytic grade. Enzymes (Taq polymerase, Bst polymerase and RNAase A), Taq buffer, MgCl2 and dNTPs were purchased from Bangalore Genei (Bangalore, India). 2.2.2. Protocol: In order to avoid surface contamination, the seeds were washed with 0.2% Cetrimide for 3 min, followed by treatment with 0.5% streptomycin sulphate and 0.5% bavistine for 5 min each. After these treatments the seeds were rinsed with 70% alcohol for 1 min andfinally washed with sterile double distilled water and kept overnight. 1g seeds were pulverized to fine powder by liquid nitrogen in a chilled mortar and pestle followed by the addition of 100 mg of poly vinyl pyrollidone (PVP, insoluble) and 10 ml pre-heated IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) CTAB buffer (containing 0.2 % β-mercaptoethanol). The slurry was transferred into autoclaved 50 ml centrifuge tube and incubated at 60oC for 1 hr. 10 ml of Chloroform, Isoamyl alcohol (CHCl3: IAA, 24:1) was added to the centrifuge tubes and mixed carefully for 15 min. The content was centrifuged at 8000 rpm for 15 min. at 15oC. The upper phase was transferred into new autoclaved centrifuge tubes. 10µl of RNAase was added and the tubes were incubated at 37oC for 30 min. 10 ml of CHCl3: IAA (24:1) was added carefully and the tubes were centrifuged at 8000 rpm for 15min at 15oC. The upper phase was transferred again into autoclaved centrifuge tube and 0.5 vol. of 3M Potassium acetate (pH 5.2) was added. For DNA precipitation equal volume of chilled isopropanol (chilled absolute ethanol was also used) was used and the tubes were kept at -20oC for 2 hrs. It was recentrifuged at 8000 rpm for 15 min at 4oC. The supernatant was discarded and the pellet was washed with 70% ethanol, air dried and dissolved in 250 µl of sterile water. The DNA thus obtained was purified by DNA purification (HiPurA, India) kit according to manufacturer’s instructions. 2.3. Polymerase Chain Reaction (PCR) Amplification: The PCR was carried out in 20 µl reaction volume containing 50ng DNA, 0.5 u/µl Taq DNA polymerase, 1.66 mM MgCl2, 30 pmol 10-mer primers, 200 µM of each dNTPs, 2x Taq polymerase buffer with minor changes as described by Shaik et al. (2006). The final volume was made-up with sterile MilliQ water. The amplifications were carried out in DNA thermal cycler (Eppendorf, Germany). The PCR amplification conditions for RAPD consisted of initial step of denaturation at 94°C for 4 min, 35 cycles of denaturation at 94°C for 1 min, annealing at 35°C for 1 min, extension at 72°C for 2 min, followed by final extension at 72°C for 10 min. The amplified DNA was loaded on 1.2% agarose gel in 0.5x TBE buffer containing 10 µl of EtBr (10mg/ml) and photographed using gel documentation system (UVP, Germany). Twenty 10-mer RAPD primer series OPAA, purchased from Qiagen, USA and five (BG series) from Bangalore Genei (India) were screened. 2.4. Gel purification, Cloning and sequencing of RAPD amplified product: RAPD fragment was excised from the gel with a sharp and sterile scalpel to avoid any contamination. Elution of DNA from agarose gel was carried out using MiniElute® kit from Qiagen (USA) following manufacturer’s instructions and the product was run on 1.2% gel along with the Gene Rular DNA ladder, to check the presence of the desired product. The eluted DNA was ligated into pGEM®-T easy vector (Promega, November – December 2013 Page 766 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology USA). Ligation reaction was carried out in 10μl reaction containing 10x ligase buffer (5.0 μl), pGEM®-T easy vector (0.5 μl), T4 DNA Ligase (1.0 μl) and PCR product 3.0 μl) and the final volume was set up with autoclaved Milli Q water. Competent cells of E. coli DH5α were prepared by CaCl2 method (Sambrook et al. 2001) and 5μl of the ligation mixture was mixed with an aliquot of 100 μl competent cells. The transformed cells were plated on LB-X-gal/Amp plates and the recombinant colonies were selected through blue-white screening. The plasmid was isolated from the positive bacterial colonies using plasmid isolation kit (Qiagen, Germany). The cloned fragments were sequenced using T7 primers through the centre for Genomic Application, New Delhi, India. 2.5. Design of LAMP Oligonucleotides: A total set of four LAMP primers were designed using Primer Explorer V3 (http://primerexplorer.jp/elamp3.0.0/index.html) for the specific detection of PCR product. The primer set consisted of two outer (F3 and B3), and two inner (FIP and BIP); the inner primers cover two distinct sequences of the target (F1c/B1c and F2c/B2c). Sequences of the LAMP primers are given in table 1. 2.6. LAMP reaction: The LAMP reaction was carried out in a 25 µl reaction volume containing 60pmol each of the primers FIP and BIP, 10 pmol each of the outer primers F3 and B3, 8mM MgSO4, 1.4mM dNTPs, 0.8M betaine, 10 units of the Bst DNA polymerase and 2 µl of DNA template. The optimum temperature for the LAMP reaction was 60°C. 1μlSYBR Green-Ι dye was added at the end of the reaction. Visual inspection for amplifications was performed through observation of colour change following addition of 1μl of SYBR Green I (fluorescent dsDNA intercalating dye) to the tube. ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) 3. RESULTS RAPD reaction was performed in order to find out unique specie specific monomorphic bands present in all the samples, meant for LAMP analysis. Twenty five 10-mer RAPD primers were used of which six did not amplify the DNA. Each RAPD reaction was repeated thrice and only reproducible bands were taken in to account. A total of 524RAPD bands (table 2) were obtained and to develop the LAMP marker, we analyzed the nucleotide sequences of 5 species-specific RAPD amplicons, consisting of 5 DNA fragments for N. saitva. From the resulting nucleotide sequences, one unique RAPD amplicon from primer OPAA-9 has been registered in the NCBI Gene Bank dbGSS, and used to develop RAPD derived LAMP marker (Fig. 1). The specific amplicon of 600bp (fig.2) RAPD fragment, specific for all the accessions of N. sativa, was used for designing primers of LAMP reaction. The reaction was carried out using genomic DNA as a template to determine the optimal temperature and reaction time and to evaluate the use of primers. LAMP product formation was detected at a temperature range of 60−64°C and consequently, 60°C was considered to be the optimal reaction temperature for the LAMP assay. The tube containing the amplified products were visualised in the presence of fluorescent intercalating dye SYBR Green I under UV transilluminator. In case of positive amplification, the original colour of the dye was changed into green that was judged under natural light as well as under UV light (302 nm) with the help of UV transilluminator. In case of negative control (Catharanthus roseus) there was no amplification, the original orange colour of the dye was retained (Figure.3) Figure.1. RAPD profile of Kalonji (N. sativa) representing specific band present in all accessions amplified with OPAA-09 primer.Lane M, molecular marker 200-1700 bp, Lanes K1–K5 corresponds to the 5 accessions (K1Kolkatta, k2- Govindpuri- New Delhi, K3- KhariBaowli- Delhi, K4- Aligarh- Uttar Pradesh, K5- DehradunUttarakhand) IJRPB 1(6) www.ijrpb.com November – December 2013 Page 767 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) gctgcaccacctctgtggctgggacctctggtactgcttccacctgtgtctggcccatttgccccgacggcgccggcagcggggcga ggacaccctgctctacgatgccttcgtggtctttgacaaggcgcagagtgcagtggccgactgggtgtacaacgagctccgcgtgca gctggaggagcgccgcgggcgccgggcgctccgcctctgcctggaggagcgagactggctccctggcaagacgctcttcgagaa cctgtgggcctcggtctacagcagccgcaagaccatgttcgtgctggaccacacggaccgggtcagcggcctcctgcgcgccagct tcctgctggcccagcagcgcctgttggaggaccgcaaggacgtcgtggtgctggtgatcctgcgccccgccgcctaccggtcccgct acgtgcggctgcgccagcgcctctgccgccagagcgtcctcctctggccgcaccagcccagtggccagggtagcttctgggccaac ctgggcatggccctgaccagggacaaccgccacttctataaccggaacttctgccggggccccacgacagccgaatagcac Figure.2.Nucleotide sequence of RAPD amplicon (600 bp) of N. sativa used for development LAMP marker Figure.3.Analysis of LAMP under UV light (A) and natural light (B). 1-5 accessions of Nigella sativa.(1- Kolkatta, 2- Govindpuri- New Delhi, 3- KhariBaowli- Delhi, 4- Aligarh- Uttar Pradesh, 5- Dehradun- Uttarakhand, CNegative control (Catharanthus roseus) Name F3 B3 FIP (F1c+F2) BIP (B1+B2c) Table 1.Primer Sequences used in this study sequence (5′ → 3′) catttgccccgacggc cggctgctgtagaccga tcggccactgcactctgcgcgaggacaccctgctct tccgcctctgcctggaggaccacaggttctcgaagagc Bases 16 17 36 38 Table 2.Number of amplified products generated by 20 arbitrary primers in 5 accessions of Kalonji (Nigella sativa) Primer code sequence (5′ → 3′) No. of amplification products Fragment size (kb) OPAA -01 AGACGGCTCC 37 0.45-1.20 OPAA -02 GAGACCAGAC 31 0.3-1.15 OPAA -03 TTAGCGCCCC 29 0.3-1.20 OPAA -04 AGGACTGCTC 0 0 OPAA -05 GGCTTTAGCC 20 0.3-1.00 OPAA -06 TCAAGCTAAC 11 0.5-1.10 OPAA -07 CTACGCTCAC 24 0.2-1.20 OPAA -08 TCCGCAGTAG 29 0.4-1.40 OPAA -09 AGATGGGCAG 35 0.5-1.20 OPAA -10 TGGTCGGGTG 34 0.3-1.15 OPAA -11 ACCCGACCTG 32 0.35-1.10 OPAA -12 GGACCTCTTG 40 0.35-1.20 OPAA -13 GAGCGTCGCT 26 0.35-1.10 OPAA -14 AACGGGCCAA 14 0.5-1.00 OPAA -15 ACGGAAGCCC 14 0.3-1.20 OPAA -16 GGAACCCACA 33 0.3-1.20 OPAA -17 GAGCCCGACT 23 0.3-1.10 OPAA -18 TGGTCCAGCC 39 0.4-1.15 OPAA -19 TGAGGCGTGT 28 0.3-1.20 OPAA-20 TTGCCTTCGG 32 0.4-1.20 Total 524 IJRPB 1(6) www.ijrpb.com November – December 2013 Page 768 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology 4. DISCUSSION Correct identification of plants forming the drug is a prerequisite and fundamental to whole realm of medicine and science. Most of the regularity guidelines and pharmacopoeia recommend macro- and microscopic evaluation and chemical analysis of botanical material for quality and quantity control and standardization (Anonymous, 1996). Morphological or macroscopic identification of plant materials is based on parameters like shape, size, texture, colour, surface feature, odour, taste and other organoleptic characters that are compared to standard reference materials. Though this method is simple and direct, its accuracy and authenticity which are sometimes subjective, depends on examiners. Histological or microscopic examinations are done to study comparative microscopic inspection of broken as well as powdered, crude, botanical materials to reveal the characteristics of tissue structure and arrangement of cells in different organs and tissues. Chemical authentication establishes a chemical composition of plant, which is used for differentiation. The variation of chemical composition may hinder the authentication, and in some cases, may be misleading if the samples are adulterated. Moreover, it is difficult to distinguish closely related species due to similar chemical compounds. Molecular or DNA-based markers are now becoming a popular means for the identification of medicinal plants (Yip, 2007). Molecular markers have the advantage over chemical markers as the genetic composition is unique for each individual and is least affected by age (Kumble, 2003), environmental factors and physiological conditions (Macbeath and Schreiber, 2000), harvest, storage and processing of the samples (Schweitzer, 2003). Molecular markers are not stage and tissue specific and thus can be detected at any stage of development. Ours is the first attempt to characterize Kalongi using LAMP markers. Although in earlier reports RAPDs were used for the authentication purpose (Rivera-Arce, 2007; Shinde, 2007; Hammad and Qari 2010; Ganie, 2012), however, these markers are very sensitive and the big blow to these markers are IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) reproducibility problem. Therefore, in the present study RAPDs were converted into LAMP markers. These markers are very specific and highly reproducible because these markers could amplify a specific gene from the whole genome discriminating a single nucleotide difference (Parida, 2008). As the reaction is carried out under optimal and isothermal conditions, therefore, there are negligible chances of inhibition reaction at the later stage of amplification compared with the PCR. The results can be easily monitored by checking the turbidity obtained from the precipitate and most importantly the detection of the desired gene could be completed in a single step by incubating mixture of gene sample, primers, DNA polymerase with strand displacement activity and substrates at constant temperature (Parida, 2008). In our study, the amplification was not detected when the concentration of the template was 0.3 ng, however when the template concentration was in the range of 0.8-1.5 ng, amplifications occurred; therefore, it was thought that DNA concentration of 0.8 ng is the detection limit in N. sativa. Such type of results was also observed in the studies of P. Ginseng (Sasaki, 2008) in which 0.5 ng of template was the detection limit. The optimized reaction parameters that showed positive results were 10 ng template DNA, 10pmol of outer primers (F3 and B3), 60pmol of each of forward internal and backward outer primers (FIP and BIP), 20 mM reaction buffer, 10 mmMgSO4, 0.8 M betaine and 10 units of Bst DNA polymerase. The optimum temperature for the reaction was set at 60°C, which is considered optimum for the activity of Bst DNA polymerase. The use of LAMP markers for the authentication of medicinal plants, although is rare; however, there are some recent reports in which the technique has been successfully applied for the identification purposes and some of which include Curcuma longa (Sasaki and Nagumo; 2007), Panex ginseng (Sasaki, 2008), Catharanthus roseus (Choudhry, 2011). We have developed LAMP, a rapid, highly sensitive, and specific method for the authentication of N. sativa. The present study November – December 2013 Page 769 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology could be applicable to identify N. Sativa to differentiate the herb from the spurious and adulterated drugs sold in the market in the name of geniuine drugs. Efforts are in progress to develop LAMP markers to medicinal plants in order to provide accurate method for authenticating the medicinal plants. 5. CONCLUSION ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) based on RAPD analysis. Genet. Mol. Res. 9, 2010, 2412-2420. Kanter, M., Meral, I.,Dede, S., Effects of Nigella sativa L. and Urticadioica L. on lipid peroxidation, antioxidant enzyme systems and some liver enzymes in CCl4-treated rats. J. Vet. Med. Physiol. Pathol. Clin. Med. 50, 2003, 264268. LAMP technology could be efficiently used to characterize the medicinal plants like of N. sativa. By analysing the genetic profiling it is possible to identify the said drug; this information could be employed for identification of authenticN. sativa devising from the spurious and adulterated drugs. Khatoon, S., Mehrotra, S., Shome, U., Mehrotra, B.N., Analysis of commercial Ratanjot; by TLC fluorescence fingerprinting. Int. J. Pharmacol. 31, 1993, 269-277. ACKNOWLEDGMENTS MacBeath, G., Schreiber, S.L., Printing proteins as microarrays for high-throughput function determination. Sci., 289, 2000, 1760-1763. This work was financed by the CCRUM, AYUSH, Ministry of Health and Family Welfare, Government of India. REFERENCES Anonymous, The Useful Plants of India. PID, CSIR, 1996, New Delhi Bamosa A.O, Ali B.A, Al-Hawsawi Z.A, The effects of thymoquinone on blood lipids on rats, Indian. J. Physio. Pharmacol, 46, 2002, 195201. Chaudhary A.A, Hemant, Mohsin M, Ahmad A, Application of loop-mediated isothermal amplification (LAMP)-based technology for authentication of Catharanthus roseus (L.) G. Don. Protoplasma, 249, 2012, 417-422. Chaudhry N.M.A, Tariq P, In-vitro anti bacterial activities of Kalonji, Cumin and Poppy Seed. Pak. J. Bot, 40, 2008, 461-467. Doyle J.J, Doyle J.J, Isolation of plant DNA from fresh tissue, Focus, 12, 1990, 13-15. Dubey N.K, Kumar R, Tripathi P, Global promotion of herbal medicine: India’s opportunity. Curr. Sci. 86, 2004, 37-41. Ganie S.H, Srivastava P.S, Narula A, Ali Z, Sharma M.P., Authentication of shankhpushpi by RAPD markers. Eurasia. J. Biosci, 6, 2012, 39-46. Hammad I, Qari S.H, Genetic diversity among Zygophyllum (Zygophyllaceae) populations IJRPB 1(6) www.ijrpb.com Kumble, K.D., Protien microarrays, new tools for pharmaceutical development. Analyt. Bio. Chem. 377, 2003, 812-819. Paarakh, P.M., Nigella sativa Linn.- A Comprehensive Review. Ind. J. Nat. Prod. Resour. 1, 2010, 409-429. Parida, M., Sannarangaiah, S., Dash, P.K., Rao, P.V.L., Morita, K., Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev. Med. Virol. 18, 2008, 407-421. Rivera-Arce, E., Gattuso, M., Alvarado, R., Zarate, E., Aguero, J., Feria, I., Lozoya, X., Pharmacognostical studies of the plant drug Mimosa tenuifloraecortex. J. Ethnopharmaco. 113, 2007, 400-408. Sasaki, Y., Komatsu, K., Nagumo, S., Rapid detection of Panax ginseng by loop-mediated isothermal amplification and its application to authentication of Ginseng. Biol. Pharm. Bull, 31, 2008, 1806-1808. Sasaki, Y., Nagumo, S., Rapid identification of Curcuma longa and C. aromatic by LAMP. Biol. Pharm. Bull, 30, 2007, 2229-2230. Schweitzer, B., Predki, P., Synder, M., Microarrays to characterize protein interactions on a whole-protoeme scale. Proteomics. 3, 2003, 190-199. Shaik Y.B, Castellani M.L, Perrella A, Conti F, Salini V, Tete S, Madhappan B, Vecchiet J, De Lutiis M.A, Caraffa A, Cerulli G, Role of quercetin (a natural herbal compound) in allergy November – December 2013 Page 770 Mohd Asif et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) and inflammation, J. Biol. Regul. Homeost. Agents, 20(3-4), 2006, 47-52. Medicine, Evi. Based Complemen. Alterna. Med, 4, 2007, 21-23. Shinde M, Dhalwal K, Mahadik K.R, Joshi, K.S, Patwardhan B.K, RAPD Analysis for Determination of Components in Herbal Yip P.Y, Chau C.F, Mak C.Y, Kwan H.S, DNA methods for identification of Chinese medicinal materials, J. Chin. Med, 2, 2007, 1-19. IJRPB 1(6) www.ijrpb.com November – December 2013 Page 771 Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Comparative in-vitro dissolution study of five brands of Diclofenac sodium delayed release tablets in QbD environment V Malleswari Bai*1, M Prasada Rao1, M Chandana1, K Naga Harini1, B Naga Deepthi1, K Thirumala Devi1, 2 P Lakashmana Rao1, Vinay U rao and J Naga raja1 1. Department o f Pharmaceuitical Analysis, Medarametla Anjamma Masthanrao College of Pharmacy, Narasarao Pet, Guntur district, Andhra Pradesh, India. 2. Institutes of Pharmaceutical Sciences, Hyderabad-500049 *Corresponding author: E.Mail:[email protected] ABSTRACT Diclofenac sodium tablets are available as delayed release tablets in the market. Delayed release tablets are typically produced by coating the tablet with enteric coating polymers. These polymers provide the resistance of drug release in acidic environment of stomach and allow the drug to be released in alkaline environment of the intestine. A large number of enteric polymers are available which provide excellent protection to drug release in acidic environment. However, each polymer dissolves at different alkaline pH. For e.g. Eudragit L-100 dissolves at pH 6 and above while Eudragit S-100 dissolves at pH 6.5 and above. HPMC Phthalate P5.5 dissolves at pH 5.5 and above while HPMC Phthalate P dissolves at pH 6 and above. Hence, for the same drug the bioavailability can subtly but significantly change based on which enteric polymer is used to provide the delayed release. The aim of the current work was to comparatively evaluate five brands of Diclofenac sodium enteric coated tablets and determine which brands may be equivalent to each other based on in vitro testing. Comparative dissolution profile testing was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It was determined that brand 1 and 5 are equivalent to each other while brands 2, 3 and 4 are equivalent to each other. Similarity factor f2 was used for comparing the dissolution profiles. Alcohol dumping studies indicated that only brand 1 was able to withstand the enteric effect at 40% level of alcohol. All other marketed brands fail the alcohol dumping test. This indicates that patients may have to counsel not to concomitantly consume alcohol while on Diclofenac sodium delayed release tablets. Key words: Diclofenac sodium, Quality by design (QbD), Delayed release, Dissolution test INTRODUCTION Quality by Design (QbD) is a concept first outlined by well-known quality expert Joseph M Juran in various publications, most notably Juran on Quality by Design. Juran believed that quality could be planned, and that most quality crises and problems relate to the way in which quality was planned in the first place. While Quality by Design principles has been used to advance product and process quality in every industry, and particularly the automation industries, they have most recently been adopted by the U.S Food and Drug administration (FDA) as a vehicle for the transformation of how drugs are discovered, developed, and commercially manufactured (Juran, 1992). MATERIALS AND METHODS Development of a predictive dissolution method: The effects of dissolution medium pH, stirring speed, volume of the dissolution medium, type of apparatus used were systemically evaluated to develop the predictive dissolution method using USP apparatus 2 .Effect of dissolution medium pHof both the innovator product and the four brands were subjected to dissolution testing using USP apparatus 2 at 50 rpm in 900 mL of various media including water, 0.1 N HCl, pH 5.5 phosphate buffer, and pH 6.8 phosphate buffer. The drug release of the marketed samples in comparison with the innovator at different time intervals was obtained in all the mediums. The similarity factor of the brands using innovator product as the reference is calculated Effect of dissolution medium volume: The drug release of innovator products and all the marked brands was evaluated using pH 1.2(0.1N HCl) dissolution medium volumes of1000ml and 500ml. The stirring speed was 50 rpm in each case. The drug release profile of the marketed samples in comparison with the innovator product at various time intervals were obtained in all two volumes. The similarity factor of the brands using innovator product as the reference is calculated Effect of dissolution medium: An initial attempt at developing the discriminating dissolution method that would be predictive of in vivo performance was made Effect of stirring speed: Dissolution testing of all the marketed samples and the innovator product was conducted at25, 50, 75, and 100 rpm in 900 mL of pH 1.2(0.1NHCl) dissolution medium. The similarity IJRPB 1(6) November – December 2013 www.ijrpb.com Page 772 Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology factor of the brands using innovator product as the reference is calculated  Effect of type of dissolution apparatus: Dissolution testing of all the marketed samples and the innovator product was conducted using both USP1 (Basket) and USP2 (Paddle) apparatus in 900ml of pH 1.2(0.1NHCl) dissolution medium. The drug release profiles of all the marketed samples in comparison with the innovator product at various time intervals were obtained. The similarity factor of the brands using innovator product as the reference is calculated  QbD development process includes:  Begin with the target product profile that describes the use, safety and efficacy of the product.  Defining a target quality profile that will be used by formulators and process engineers as a quantitative surrogate for aspects of clinical safety and efficacy during product development.  Gather relevant prior knowledge about the substance, potential excipients and process operation.  Design a formulation and identify the quality attributes to the final product that must be controlled to meet the target product quality profile.  Design a manufacturing process to produce a final product having this critical material attributes.  Identify the critical process parameters and raw material attributes that must be controlled to achieve these critical material attributes of the final product.  Establish a control strategy for the entire process that may include input material controls, process controls and monitors design space around individual or multiple unit operation and/ or final product tests.  Continually monitor and update the process to assure consistent quality.      ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Dissolution is the process by which a solid solute enters a solution, and is characterized by rate (amount dissolved by time). In the pharmaceutical industry, it may be defined as the amount of drug substance that goes into solution per unit time under standardized conditions of liquid/solid interface, temperature and solvent composition. Dissolution is the quality control measure and potential to provide in sight into the in vivo performance of the drug product. In vitro release test that predicts the drug in vivo would be optimal and highly desirable. A variety of designs of apparatus for dissolution testing have been proposed and tested, varying from simple beaker with stirrer to complex systems. Different apparatus, procedures and techniques are required for different dosage forms because of significant differences in formulation design and the physicochemical properties of the drugs. Dissolution tests have been developed for various drug delivery systems including immediate release solid dosage forms, several controlled release solid dosage forms and many novel and special dosage forms. Most of the tests with recommended apparatus and other specifications are now available as compendial standards in Pharmacopoeias and are used in pharmaceutical analysis and drug development for the various drug delivery systems. Dissolution testing and drug release:  Dissolution testing has been widely used as the primary tool to evaluate drug release RESULTS AND DISCUSSION Five brands of Diclofenac sodium delayed release tablets 50 mg were procured from the market and subjected to assay and comparative dissolution profile testing as per USP guidelines for determining in vitro equivalence of modified release products. Assay of Diclofenac sodium delayed release tablets: Twenty tablets were weighed and crushed using mortar and pestle. Quantity of powder equivalent to 100 mg of Diclofenac sodium was weighed accurately and transferred to 100 ml volumetric flask. Approximately 70 ml of methanol AR grade was added and syndicated for 15 minutes. The volume was made up to 100 ml with methanol and filtered. From the clear filtrate and aliquot equivalent to 100 ppm was pipette out and transferred to 10 ml volumetric flask. The volume was made up to 10 ml with Methanol (10 µg/ml solution). The absorbance of this IJRPB 1(6) November – December 2013 Quality by Design for drug release Two primary aspects: 1. Clinical relevance of release and stability specifications 2. Correlation between process parameters and ability to achieve specifications (and therefore remain clinically relevant) www.ijrpb.com Page 773 Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology solution was measured on UV spectrophotometer at 276 nm wavelength. The drug content was calculated by simultaneously measuring the absorbance of a standard 10 µg/ml solution of Diclofenac sodium. The assay values for all five brands are given in Table 1. Disintegration test for Enteric coated tablets (IP): The DT test for enteric coated tablets as described in IP was performed for 6 tablets of each brand and it was observed that all brands pass this test Comparative dissolution testing in 0.1N HCl: It is mandatory for all delayed release products to show < 10% drug release in 0.1N HCl when in vitro dissolution testing is performed for 2 hours in this medium. The results for the dissolution testing of the 5 brands are given in Table 2 and shown in Figure.1. All five brands passed the criteria of <10% in two hours in pH 1.2 medium. Comparative dissolution testing in pH 5.5: pH 5.5 simulates the duodenum and upper intestinal portion. Comparative dissolution testing was conducted in pH 5.5 acetate buffer for 1 hour (Figure.2) The dissolution profiles were statistically compared by calculating the similarity factor (f2). The f2 factor for brand 2, 3, 4 and 5 was calculated by comparing with brand 1. Only brand 5 showed f2 > 50. Hence this may be considered as equivalent to brand 1 for dissolution profile testing in pH 5.5. The f2 factor for brand 1, 3, 4 and 5 was calculated by comparing with brand 2. Brand 3 and 4 showed f2 > 50. Hence these may be considered as equivalent to brand 2 for dissolution profile testing in pH 5.5. The f2 factor for brand 1, 2, 4 and 5 was calculated by comparing with brand 3. Brand 5 showed f2 > 50. Hence this may be considered as equivalent to brand 3 for dissolution profile testing in pH 5.5. The f2 factor for brand 1, 2, 3 and 5 was calculated by comparing with brand 4. Brand 2 showed f2 > 50. Hence this may be considered as equivalent to brand 4 for dissolution profile testing in pH 5.5. The f2 factor for brand 1, 2, 3 and 4 was calculated by comparing with brand 5 as standard. Only brand 1 showed f2 > 50. Hence this may be considered as equivalent to brand 5 for dissolution profile testing in pH 5.5. Comparative dissolution testing in pH 6.0: pH 6.0 simulates the duodenum and upper intestinal portion. Comparative dissolution testing was conducted in pH 6.0 Phosphate buffer for 1 hour. (Figure.3) ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) comparing with brand 1. Only brand 5 showed f2 > 50. Hence this may be considered as equivalent to brand 1 for dissolution profile testing in pH 6.0. The f2 factor for brand 1, 3, 4 and 5 was calculated by comparing with brand 2. Brand 3 and 4 showed f2 > 50. Hence these may be considered as equivalent to brand 2 for dissolution profile testing in pH 6.0. The f2 factor for brand 1, 2, 4 and 5 was calculated by comparing with brand 3. Brand 2 and 5 showed f2 > 50. Hence these may be considered as equivalent to brand 3 for dissolution profile testing in pH 6.0. The f2 factor for brand 1, 2, 3 and 5 was calculated by comparing with brand 4. Brand 2 and 3 showed f2 > 50. Hence these may be considered as equivalent to brand 4 for dissolution profile testing in pH 6.0. The f2 factor for brand 1, 2, 3 and 4 was calculated by comparing with brand 5. Brand 1 and 3 showed f2 > 50. Hence these may be considered as equivalent to brand 5 for dissolution profile testing in pH 6.0. Comparative dissolution testing in pH 6.8: pH 6.8 simulates the middle and lower portion of the gut. Comparative dissolution testing was conducted in pH 6.0 Phosphate buffer for 1 hour. (Figure.4). The dissolution profiles were statistically compared by calculating the similarity factor (f2). The f2 factor for brand 2, 3, 4 and 5 was calculated by comparing with brand 1. Brand 2 and 4 showed f2 > 50. Hence these may be considered as equivalent to brand 1 for dissolution profile testing in pH 6.8. The f2 factor for brand 1, 3, 4 and 5 was calculated by comparing with brand 2. Brand 3 and 4 showed f2 > 50. Hence these may be considered as equivalent to brand 2 for dissolution profile testing in pH 6.8. The f2 factor for brand 1, 2, 4 and 5 was calculated by comparing with brand 3. Brand 1 and 5 showed f2 > 50. Hence these may be considered as equivalent to brand 3 for dissolution profile testing in pH 6.8. The f2 factor for brand 1, 2, 3 and 5 was calculated by comparing with brand 4. Brand 2 and 5 showed f2 > 50. Hence these may be considered as equivalent to brand 4 for dissolution profile testing in pH 6.8. The f2 factor for brand 1, 2, 3 and 4 was calculated by comparing with brand 5. Brand 1, 2 and 3 showed f2 > 50. Hence these may be considered as equivalent to brand 5 for dissolution profile testing in pH 6.8. The dissolution profiles were statistically compared by calculating the similarity factor (f2). The f2 factor for brand 2, 3, 4 and 5 was calculated by The multimedia dissolution study indicates that the differences in the rate and extent of dissolution between different brands are significantly more at pH 5.5 and pH 6 than at pH 6.8. This may most likely be due to the fact that each brand may have been coated with enteric materials of different chemistries having different solubility profiles in IJRPB 1(6) November – December 2013 www.ijrpb.com Page 774 Malleswari et.al ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Indian Journal of Research in Pharmacy and Biotechnology alkaline pH. For e.g. the reported solubility of Eudragit L100 is pH 6 and above while that of Eudragit L100-55 is pH 5.5 and above. Consequently, tablets coated with L-100-55 will show significantly faster and more complete dissolution at pH 5.5 as compared to Eudragit L-100. All pH dependent enteric polymers completely dissolve at pH 6.8 and above. Hence the difference between the brands is significantly reduced in case of dissolution profile testing in pH 6.8 buffer. In order to simulate the way the dosage form is exposed to pH change in vivo, dissolution profile testing for all brands was conducted by using the in situ pH change method. The in situ pH change method of dissolution testing indicates that all five brands achieve > 80% release within 30 minutes of reaching the pH 6.8. However, dissolution profiles for Brand 1 and brand 5 are significantly faster at pH 6 than those of brands 2, 3 and 4. Hence, from this study it may be predicted that Brands 1 and 5 may show therapeutic equivalence to each other while brands 2, 3 and 4 may be equivalent to each other. But brand 1 and 5 may not show therapeutic equivalence to brands 2, 3 and 4.(Figure.7). different solubility profiles in commonly used solvents. The probability that this may affect the intended release profile in vivo is very genuine if we consider that patients may consume alcohol when under treatment with modified release products. The solubility profile of the polymer in alcohol may adversely affect the release rate of the drug from the dosage form and the actual drug release may be entirely different from the intended release. Hence, the US FDA in its latest guidelines has mandated that the alcohol dumping studies should be carried out for modified release products in order to demonstrate that the dosage form is able to perform within its specified standards even in presence e of significant levels of alcohol. For the five marketed brands of Diclofenac sodium delayed release tablets, a comparative alcohol dumping study was performed in 0.1N HCl without alcohol, and 0.1N HCl with 5%, 10% 20% and 40% v/v of alcohol respectively. The dissolution profile testing was carried out for two hours. The study indicates that only Brand 1 is able to maintain the enteric effect of < 10% release in acidic pH even in presence of 40% alcohol. All other brands fail the alcohol dumping test at 40% level of alcohol. Brand 2 fails the test even at 10% and 20% level of alcohol. (Figure.8). Alcohol dumping study: For modified release products, different types of polymers are used to get the same kind of effect. Each of these polymers has Table.1. Assay values for all five Brands of Diclofenac sodium 50 mg delayed release tablets BRANDS % Assay Brand 1 98.76 Brand 2 99.27 Brand 3 97.54 Brand 4 98.04 Brand 5 97.56 Table.2.Comparative dissolution profile testing in 0.1N Hcl Time Brand1 Brand2 Brand3 Brand4 Brand5 0 30 45 60 120 0 2.78 5.8 7.9 9.17 0 1.45 3.55 5.07 6.17 0 2.87 4.07 6.27 6.59 0 2.87 3.09 4.13 5.87 0 1.56 2.34 4.09 4.35 Figure.1. Dissolution profiles for 5 brands of Diclofenac sodium delayed release tablets in 0.1N HCl IJRPB 1(6) www.ijrpb.com Figure.2.Comparative dissolution profile of five brands in ph 5.5 November – December 2013 Page 775 Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Figure.3.Comparative Dissolution Profile In Ph 6.0 Phosphate Buffer Figure.4.Comparative Dissolution Profile In Ph 6.8 Phosphate Buffer Figure.5. Comparative Dissolution Profile In Ph 6.0 Phosphate Buffer Figure.6.Comparative Dissolution Profile In Ph 6.8 Phosphate Buffer Figure.7. Dissolution profile by in situ ph change method Figure.8.Alcohol Dumping study for Diclofenac sodium delayed release tablets market brands SUMMARY AND CONCLUSION dissolves at pH 5.5 and above while HPMC Phthalate P dissolves at pH 6 and above. Hence, for the same drug the bioavailability can subtly but significantly change based on which enteric polymer is used to provide the delayed release. Diclofenac sodium tablets are available as delayed release tablets in the market. Delayed release tablets are typically produced by coating the tablet with enteric coating polymers. These polymers provide the resistance of drug release in acidic environment of stomach and allow the drug to be released in alkaline environment of the intestine. A large number of enteric polymers are available which provide excellent protection to drug release in acidic environment. However, each polymer dissolves at different alkaline pH. For e.g. Eudragit L-100 dissolves at pH 6 and above while Eudragit S-100 dissolves at pH 6.5 and above. HPMC Phthalate P5.5 IJRPB 1(6) www.ijrpb.com The aim of the current work was to comparatively evaluate five brands of Diclofenac sodium enteric coated tablets and determine which brands may be equivalent to each other based on in vitro testing. Comparative dissolution profile testing was carried out in pH 5.5, pH 6 and pH 6.8 buffers. It was determined that Brand 1 and 5 are equivalent to each other while brands 2, 3 and 4 are equivalent to November – December 2013 Page776 773 Page Malleswari et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) each other. Similarity factor f2 was used for comparing the dissolution profiles. alcohol while on Diclofenac sodium delayed release tablets. Alcohol dumping studies indicated that only brand 1 was able to withstand the enteric effect at 40% level of alcohol. All other marketed brands fail the alcohol dumping test. This indicates that patients may have to counsel not to concomitantly consume ACKNOWLEDGEMENT The authors are grateful thanks to Indian Pharmaceutical Sciences, Arabindo pharma lim, EMCO industries-hyd, FMC-US, Ashaland specialty chemicals-US for providing gift samples of Diclofenac Sodium. REFFERECES 1. Juran JM, Juran on Quality by Design, The Free Press, A Division of Macmillan, Inc., New York, 1992, 407-425 2. Kearney PM, Baigent C, Godwin J, Halls H, Emberson JR, Patrono C: Do selective cyclooxygenase-2 inhibitors and traditional non-steroidal anti-inflammatory drugs increase the risk of atherothrombosis? Meta-analysis of randomised trials, BMJ, 3, 2006, 1302 3. Solomon DH, Avorn J, Sturmer T, Glynn RJ, Mogun H, Schneeweiss S: Cardiovascular outcomes in new users of coxibs and Nonsteroidal antiinflammatory drugs: high-risk subgroups and time course of risk, Arthritis Rheum, 54(5), 2006, 137889. 4. FitzGerald GA, Patrono C, The coxibs, selective inhibitors of cyclooxygenase-2, N Engl J Med, 345(6), 2001, 433-42. 5. Graham DJ: COX-2 inhibitors, other NSAIDs, and cardiovascular risk: the seduction of common sense, JAMA, 296(13), 2006, 1653-6. 6. Brater DC, Renal effects of cyclooxygyenase-2selective inhibitors, J Pain Symptom Manage, 23(4 Suppl), 2002, 15-20. 7. Sigma Aldrich Gan TJ: Diclofenac: an update on its mechanism of action and safety profile, Curr Med Res Opin, 26(7), 2010, 1715-31. IJRPB 1(6) www.ijrpb.com November – December 2013 Page 773 Page 777 Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Development and validation of a stability indicating HPLC method for analysis of Altretamine in bulk drug and pharmaceutical formulations M. Karimulla Santhosh, A. Sreedevi, L. Kalyani, A. Lakshmana Rao* V.V. Institute of Pharmaceutical Sciences, Gudlavalleru, Andhra Pradesh, India. * Corresponding author: E-mail: [email protected] ABSTRACT A simple, sensitive and accurate stability indicating HPLC method has been developed and validated for determination of Altretamine in its bulk form and pharmaceutical formulations. Chromatographic separation was achieved on a Hypersil BDS C18 column (100 mm x 4.6 mm I.D., particle size 5 µm) by a mobile phase consisted of phosphate buffer and acetonitrile (90:10, v/v) with apparent pH of 3.1±0.5 and a flow rate of 1.0 mL/min. The detection wave length was set at 227 nm. An excellent linearity was observed for Altretamine in the concentration range of 25-150 µg/mL with a correlation coefficient of 0.999. The retention time was 2.533 min. The percentage assay of Altretamine was 99.98%. The method developed was validated for accuracy, precision, linearity, ruggedness, robustness, solution stability, selectivity and forced degradation studies like acidic, alkaline, oxidative, thermal, hydrolytic and photolytic stress conditions were performed as per ICH guidelines. The results demonstrated that the method would have a great value when applied in quality control and stability studies of Altretamine. Key Words: HPLC, Altretamine, Stability, Formulation. INTRODUCTION Altretamine (Figure 1) is a synthetic cytotoxic antineoplastic agent (Neil, 2006). Chemically it is N,N,N',N',N'',N''-hexamethyl-1,3,5-triazine-2,4,6triamine. Altretamine is indicated for use as a single agent in the palliative treatment of patients with persistent or recurrent ovarian cancer following firstline therapy with a cisplatin and/or alkylating agentbased combination (Wiernik, 1992). Altretamine is structurally related to the alkylating agents. Its precise mechanism of action is unknown but hydroxy methyl intermediates in the metabolism process are possibly the reactive species, and may act as alkylating agents (Rhoda, 1995). Altretamine interferes with the growth of cancer cells and slows their growth and spread in the body. Literature survey revealed that few HPLC methods (Ghiorghis, 1991; Barker, 1994) were reported for the determination of Altretamine. But no stability indicating HPLC method was reported. Hence the objective of this method is to develop and validate a simple, rapid and accurate stability indicating HPLC method (Snyder, 1997) in accordance with ICH guidelines (ICH Q2(R1), 2005; ICH Q1A(R2), 2003) for the determination of Altretamine in bulk sample and its pharmaceutical formulations. MATERIALS AND METHODS Chemicals and solvents: The working standard of Altretamine was provided as gift sample from Spectrum Labs, Hyderabad, India. The market IJRPB 1(6) www.ijrpb.com formulation CANTRET capsules (Altretamine 50 mg) were procured from local market. HPLC grade acetonitrile and water were purchased from E.Merck (India) Ltd, Mumbai, India. Potassium dihydrogen phosphate, orthophosphoric acid and triethylamine of AR grade were obtained from S.D. Fine Chemicals Ltd, Mumbai, India. Instrumentation: To develop a high performance liquid chromatographic method for quantitative determination of Altretamine using Waters HPLC system on Hypersil BDS C18 column (100 mm x 4.6 mm I.D., particle size 5 µm) was used. The instrument is equipped with an auto sampler and UV detector. A 10 μL rheodyne injector port was used for injecting the samples. Data was analyzed by using Empower 2 software. Chromatographic conditions: A mixture of phosphate buffer pH 3.1 and acetonitrile (90:10, v/v) was found to be the most suitable mobile phase for ideal chromatographic separation of Altretamine. The solvent mixture was filtered through 0.45 μ membrane filter and sonicated before use. It was pumped through the column at a flow rate of 1.0 mL/min. Injection volume was 10 µL and the column was maintained at a temperature of 300C. The column was equilibrated by pumping the mobile phase through the column for at least 30 minutes prior November – December 2013 Page 778 Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology to the injection of the drug solution. The detection of the drug was monitored at 227 nm. The run time was set at 6 minutes. Preparation of phosphate buffer pH 3.1: 2.72 grams of potassium dihydrogen phosphate was weighed and transferred into a 1000 mL beaker and dissolved. 1 mL of triethylamine solution was added to the above solution and diluted to 1000 mL with HPLC water. pH was adjusted to 3.1 with orthophosphoric acid solution. Preparation of mobile phase and diluent: 900 mL of phosphate buffer was mixed with 100 mL of acetonitrile and was used as mobile phase. The solution was degassed in an ultrasonic water bath for 5 minutes and filtered through 0.45 µ filter under vacuum. The mixture of 800 mL of water and 200 mL of acetonitrile was used as diluent. Preparation of standard solution: 10 mg of Altretamine was accurately weighed, transferred to 10 mL volumetric flask and is dissolved in 7 mL of the diluent. Sonicated the solution for few minutes to dissolve the drug completely. Then it is filtered through 0.45 μ filter and the volume is made up to 10 mL with diluent to get a concentration of 1 mg/mL stock solution. Further pipetted 1.0 mL of the above stock solution into a 10 mL volumetric flask and diluted up to the mark with diluent to obtain required concentrations. Preparation of sample solution: Twenty commercial capsules were emptied and powdered. A quantity of the powder equivalent to 10 mg of Altretamine was accurately weighed, transferred to 10 mL volumetric flask and is dissolved in 7 mL of the diluent. Sonicated the solution for few minutes to dissolve the drug completely. Then it is filtered through 0.45 μ filter and the volume is made up to 10 mL with diluent to get a concentration of 1 mg/mL stock solution. Further pipetted 1.0 mL of the above stock solution into a 10 mL volumetric flask and diluted up to the mark with diluent to obtain required concentrations of Altretamine in pharmaceutical dosage forms. Inject 10 µL of the above solution into the HPLC system. All experiments were conducted in triplicate. IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) Linearity: Several aliquots of standard solution of Altretamine was taken in different 10 mL volumetric flasks and diluted up to the mark with diluent such that the final concentrations of Altretamine were in the linearity range of 25-150 µg/mL. Evaluation of the drug was performed with UV detector at 227 nm, peak area was recorded for all the peaks. The response for the drug was linear and the regression equation was found to be y=19094x-10685 and correlation coefficient value of Altretamine was found to be 0.999. The results show that an excellent correlation exists between peak area and concentration of drug within the concentration range indicated. Limit of detection and limit of quantification: The limit of detection (LOD) and limit of quantification (LOQ) of the developed method were determined by injecting progressively low concentrations of the standard solution using the developed HPLC method. The LOD and LOQ for Altretamine were found to be 0.46 μg/mL and 1.39 μg/mL respectively. System suitability: System suitability parameters like retention time, theoretical plates and tailing factor were calculated and compared with standard values. Accuracy: The accuracy of the method was assessed by recovery study of Altretamine in the dosage form at three concentration levels. A fixed amount of preanalyzed sample was taken and standard drug was added at 50%, 100% and 150% levels. The standard concentration was fixed as 100 μg/mL and three concentration levels of 50 μg/mL, 100 μg/mL and 150 μg/mL were added to the standard concentration. Each level was repeated three times. The content of Altretamine per capsule was calculated. The percentage recovery ranges from 99.62-100.27% and the mean recovery of Altretamine was 99.92% and the recovery values of Altretamine indicate the method is accurate. Precision: The precision was determined for Altretamine in terms of system and method precision. For system precision evaluation, %RSD for Altretamine was 0.32% (limit %RSD < 2.0%). In addition, the method precision was November – December 2013 Page 779 Lakshmana Rao et.al Indian Journal of Research in Pharmacy and Biotechnology studied and the %RSD for Altretamine was 0.77% (limit %RSD < 2.0%). Ruggedness and robustness: The ruggedness of the method was determined by carrying out the experiment on different instruments by different operators using different columns of similar types. Robustness of the method was determined by making slight changes in the chromatographic conditions like changes in flow rate and mobile phase composition. It was observed that there were no marked changes in the chromatograms, which demonstrated that the HPLC method so developed is rugged and robust. Solution stability: The stability of solution under study was established by keeping the solution at room temperature for 24 hrs. The result showed no significant change in concentration and thus confirms the stability of the drug in the mobile phase used for the analysis. Analysis of the marketed formulations: The proposed method was applied for the determination of Altretamine in pharmaceutical formulatons of Altretamine capsules. 10 µL of each standard and sample solution were injected and from the peak area of Altretamine, amount of drug present in samples were computed. The result of assay undertaken yielded 99.98% of label claim of Altretamine. The assay obtained is more than 99% and no interference of impurity peak observed in Altretamine peak. Acidic d egradation s tudies: To 1 mL of stock solution of Altretamine, 1 mL of 2N hydrochloric acid was added and refluxed for 30 mins at 600 C. The resultant solution was diluted to obtain 100 µg/mL solution and 10 µL solution were injected into the system and the chromatograms were recorded to assess the stability of sample. Alkaline d egradation s tudies: To 1 mL of stock solution of Altretamine, 1 mL of 2N sodium hydroxide was added and refluxed for 30 mins at 60 0 C. The resultant solution was diluted to obtain 100 µg/mL solution and 10 µL solution were injected into the system and the chromatograms were recorded to assess the stability of sample. Oxidative degradation studies: To 1 mL of IJRPB 1(6) www.ijrpb.com ISSN: 2321-5674(Print) ISSN: 2320 – 3471(Online) stock solution of Altretamine, 1 mL of 20% hydrogen peroxide (H2O2) was added separately. The solutions were kept for 30 mins at 60 0 C. The resultant solution was diluted to obtain 100 µg/mL solution and 10 µL solution were injected into the system and the chromatograms were recorded to assess the stability of sample. Thermal degradation s tudies: The standard A l t r e t a m i n e solution w a s placed in oven at 1050 C for 6 hrs to study thermal degradation. The resultant solution was diluted to obtain 100 µg/mL solution and 10 µL solution were injected into the system and the chromatograms were recorded to assess the stability of the sample. Hydrolytic d egradation s tudies: Stress testing under hydrolytic conditions was studied by refluxing the standard Altretamine s o l u t i o n in water for 6 h r s at a temperature of 60ºC. The resultant solution was diluted to obtain 100 µg/mL solution and 10 µL solution were injected into the system and the chromatograms were recorded to assess the stability of the sample. Photolytic degradation studies: The photolytic stability of the drug Altretamine was studied by exposing the standard Altretamine solution to UV light by keeping the beaker in UV chamber for 7 days or 200 Watt hours/m2 in photo stability chamber. The resultant solution was diluted to obtain 100 µg/mL solution and 10 µL solution were injected into the system and the chromatograms were recorded to assess the stability of sample. RESULTS AND DISCUSSION In the present work, a simple, accurate and precise stability indicating HPLC method has been optimized, developed and validated for the determination of Altretamine in pharmaceutical formulations with UV detector by using Hypersil BDS C18 column (100 mm x 4.6 mm I.D., particle size 5 µm) in isocratic mode with mobile phase composition of phosphate buffer pH 3.1: acetonitrile (90:10, v/v) and pH adjusted to 3.1 with orthophosphoric acid. The use of phosphate buffer and acetonitrile in the ratio of 90:10, v/v resulted in peak with good shape and resolution. November – December 2013 Page 780