Tài liệu Xây dựng quy trình phát hiện clostridium perfringens trong thực phẩm bằng kĩ thuật pcr (polymerase chain reaction) và thử nghiệm ứng dụng

  • Số trang: 66 |
  • Loại file: PDF |
  • Lượt xem: 395 |
  • Lượt tải: 1

Đã đăng 15388 tài liệu

Mô tả:

LỜI CẢM ƠN Với lòng kính trọng và chân thành, tôi xin cảm ơn: Quý Thầy, Cô Khoa Sinh Trường Đại Học Sư Phạm Tp. Hồ Chí Minh đã cung cấp cho tôi những kiến thức quý báu trong suốt khóa học. Thầy PGS.TS. Trần Linh Thước và ThS. Nguyễn Tiến Dũng đã luôn tận tâm hướng dẫn và tạo mọi điều kiện để tôi hoàn thành tốt luận văn này. Thầy Long, các bạn Huệ, Na, Phượng, Ánh, Thanh, Loan của Trung tâm Khoa học và Công nghệ Sinh học, Phòng Thí nghiệm Vi sinh Trường Đại học Khoa học tự nhiên Đại học Quốc gia Tp. Hồ Chí Minh đã hết lòng giúp đỡ tôi trong suốt thời gian thực nghiệm. Nhân đây tôi cũng xin chân thành cảm ơn sở Giáo dục và Đào tạo Tp. Hồ Chí Minh, Ban Giám Hiệu Trường Trung học phổ thông Trần Phú đã tạo mọi điều kiện thuận lợi để tôi hoàn thành tốt khóa học này. Thành phố Hồ Chí Minh tháng - 2005 Nguyễn Thị Ngọc Yến 3 BẢNG CHỮ VIẾT TẮT AOAC : Association of Official Analytical Chemist (Hiệp Hội các nhà hóa học phân tích nhà nước) Bp : base pair (cặp base) CFU : Colony Forming Unit (đơn vị hình thành khuẩn lạc) KDa : Kilo Dalton (1.000 da) DNA : Deoxyribonucleic acid dNTP : 2'- Deoxynucleoside - 5'- triphosphate (nucleotide dùng để tổng hợp DNA) ELISA : Enzyme - linked Immunosorbent Assay (thử nghiệm hấp phụ miễn dịch gắn enzim) ISO : International Standards Organization (Tổ chức Tiêu chuẩn quốc NordVal : Nordic System for Validation of Alternative Biological Method tế) (hệ thống Nordic đánh giá phương pháp sinh học thay thế) PCR : Polymerase Chain Reaction (phản ứng chuỗi tổng hợp bằng polymerase) TAE : Tris acetic acid - Ethylene diamine tetraacetic acid (EDTA) Taq : Thermus aquaticus TE : Tris - EDTA 4 MỤC LỤC LỜI CẢM ƠN ...................................................................................................... 3 T 0 T 0 BẢNG CHỮ VIẾT TẮT ..................................................................................... 4 T 0 T 0 MỤC LỤC ............................................................................................................ 5 T 0 T 0 MỞ ĐẦU .............................................................................................................. 9 T 0 T 0 CHƯƠNG 1: TỔNG QUAN ............................................................................ 11 T 0 T 0 1.1.NGỘ ĐỘC THỰC PHẨM ............................................................................... 11 T 0 T 0 1.2.KHÁI QUÁT VỀ GIỐNG CLOSTRIDIUM ................................................. 11 T 0 T 0 1.2.1.Đặc điểm chung [4], [20] ........................................................................... 11 T 0 T 0 1.2.2.Các tác hại do Clostridium [4], [17] .......................................................... 12 T 0 T 0 1.3.ĐẶC ĐIỂM SINH HỌC CỦA CLOSTRIDIUM PERFRINGENS ............. 12 T 0 T 0 1.3.1.Lịch sử phát hiện [2], [10] ......................................................................... 12 T 0 T 0 1.3.2.Đặc điểm sinh học ...................................................................................... 13 T 0 T 0ình thái sinh tí tế bào [l1] [2] .......................................................... 13 T 0 T 0Đặc điểm nuôi cấy [1]......................................................................... 13 T 0 T 0Đặc điểm sinh hóa [8], [9] .................................................................. 14 T 0 T 0ân loại [10], [16]............................................................................. 14 T 0 T 0 1.4.NGỘ ĐỘC THỰC PHẨM DO C. PERERINGENS ..................................... 15 T 0 T 0 1.4.1. Nguyên nhân và triệu chứng ngộ độc thực phẩm do C. perfringens [5], T 0 [9] ......................................................................................................................... 15 T 0 1.4.2.Độc tố đường ruột của C. perfringens [9], [11] ........................................ 16 T 0 T 0 1.4.3.Các chỉ tiêu về c. perfringens trong thực phẩm [4].................................. 17 T 0 T 0 1.5.CÁC PHƯƠNG PHÁP PHÁT HIỆN C.PERFRINGENS TRONG THỰC T 0 PHẨM ...................................................................................................................... 19 T 0 5 1.5.1.Phương pháp nuôi cấy [4], [8] .................................................................. 19 T 0 T 0 1.5.3 Phương pháp PCR (Polymerase chain reaction) [6], [7] ......................... 20 T 0 T 0 1.5.4.So sánh ưu nhược điểm của các phương pháp ........................................ 20 T 0 T 0 1.6.KĨ THUÂT PCR TRONG PHÁT HIỆN VI SINH VẬT GÂY BỆNH T 0 TRONG THỰC PHẨM ......................................................................................... 21 T 0 1.6.1.Nguyên tắc của kĩ thuật PCR [3], [4] ........................................................ 21 T 0 T 0 1.6.2.Các yếu tố ảnh hưởng tới phản ứng PCR [3], [4] .................................... 22 T 0 T 0 1.6.3.Ưu và nhược điểm cua phương pháp PCR trong phát hiện vi sinh vật gây T 0 bệnh trong thực phẩm ........................................................................................ 24 T 0 1.7.XÁC NHẬN HIỆU LỰC CỦA PHƯƠNG PHÁP THAY THẾ ................... 25 T 0 T 0 1.7.1.Các khái niệm [13], [14] ............................................................................ 25 T 0 T 0 1.7.2.Các bước xác nhận hiệu lực [13], [14] ..................................................... 26 T 0 T 0 1.7.3.Các thông số kĩ thuật trong qui trình xác nhận hiệu lực phương pháp T 0 định tính vi sinh vật ............................................................................................ 27 T 0 1.7.4.Ý nghĩa của việc xác nhận hiệu lực .......................................................... 29 T 0 T 0 CHƯƠNG 2: VẬT LIỆU VÀ PHƯƠNG PHÁP ............................................ 30 T 0 T 0 2.1.VẬT LIỆU ......................................................................................................... 30 T 0 T 0 2.1.1.Dụng cụ và thiết bị ..................................................................................... 30 T 0 T 0 2.2.2.Hóa chất và môi trường ............................................................................. 30 T 0 T 0á chất .............................................................................................. 30 T 0 T 0ôi trường .......................................................................................... 32 T 0 T 0 2.1.3.Nguyên vật liệu .......................................................................................... 33 T 0 T 0 2.2.PHƯƠNG PHÁP .............................................................................................. 34 T 0 T 0 2.2.1.Phương pháp thu và xử lí mẫu ................................................................. 34 T 0 T 0 2.2.2.Pha loãng mẫu ........................................................................................... 34 T 0 T 0 6 2.2.3.Đồng nhất mẫu .......................................................................................... 34 T 0 T 0 2.2.4.Xác định mẫu âm tính ............................................................................... 35 T 0 T 0 2.2.5.Định lượng Clostridium perfringens ........................................................ 35 T 0 T 0 2.2.6.Phương pháp phân lập và khẳng định C. perfringens từ các mâu thực T 0 phẩm .................................................................................................................... 36 T 0 2.2.7.Phương pháp loại bỏ ôxi ra khỏi môi trường nuôi cấy............................ 37 T 0 T 0 2.2.8.Gây nhiễm C. perfringens lên mẫu thực phẩm ........................................ 38 T 0 T 0 2.2.9.Thu và xử lí khuôn DNA cho phản ứng PCR .......................................... 39 T 0 T 0 2.2.10.Điều kiện của phản ứng PCR ................................................................. 39 T 0 T 0 2.2.11.Phân tích sản phẩm PCR bằng điện di trên gelagarose ........................ 39 T 0 T 0 2.2.12.Khảo sát các điều kiện tối ưu của phản ứng PCR ................................. 39 T 0 T 0 2.2.13.Khảo sát thời gian tăng sinh tối thiểu phát hiện C. perfringens trong T 0 mẫu thực phẩm ............................................................................................... 40 T 0 2.2.14.Xác định tính chuyên biệt của cặp mồi PL ............................................. 40 T 0 T 0 2.2.15.Khảo sát độ nhạy phát hiện C. perfringens bằng PCR .......................... 40 T 0 T 0 2.2.16.Xác định giới hạn phất hiện C. perfringens ........................................... 41 T 0 T 0 2.2.17.Xác định các thông số kĩ thuật tương đổi của phương pháp PCR so với T 0 phương pháp nuôi cấy ........................................................................................ 41 T 0 2.2.18.Ứng dụng quy trình PCR để phát hiện C. perfringens trong các mẫu T 0 thực phẩm ............................................................................................................ 42 T 0 CHƯƠNG 3: KẾT QUẢ VÀ BÀN LUẬN ...................................................... 43 T 0 T 0 3.1.XÂY T 0 ĐỰNG QUY TRÌNH PHÁT HIỆN CLOSTRIDIUM PERFRINGENS ..................................................................................................... 43 T 0 3.1.1.Tính chuyên biệt của cặp mồi phái hiện Clostridium perfringens bằng T 0 phương pháp PCR .............................................................................................. 43 T 0 3.1.2.Khảo sát các điều kiện tối ưu cho phản ứng PCR ................................... 44 T 0 T 0 7ác định nồng độ Mg2+ tối ưu ........................................................... 44 T 0 P P T 0ác định nồng độ mồi tối ưu ............................................................. 45 T 0 T 0ác định nhiệt độ bắt cặp tối ưu ........................................................ 46 T 0 T 0 3.1.3.Thời gian tăng sinh cần thiết đề phát hiện C. perfringens trong thực T 0 phẩm bằng phản ứng PCR ................................................................................. 47 T 0 3.1.4.Khảo sát độ nhạy của phản ứng PCR phát hiện C. perfringens ......... 48 T 0 T 0 3.1.5.Quy trình PCR phát hiện C. perfringens trên mẫu thực phẩm ............... 49 T 0 T 0 3.2.XÁC NHẬN HIỆU LỰC CỦA PHƯƠNG PHÁP PCR ĐÃ XÂY DỰNG ĐỂ T 0 PHÂN TÍCH C. PERFRINGENS TRONG THỰC PHẨM ............................... 52 T 0 3.2.1.Phân lập và định danh các chủng C. perfringens trong thực phẩm ....... 52 T 0 T 0 3.2.2.Giới hạn phát hiện của C. perfringens trên mẫu thực phẩm .................. 56 T 0 T 0 3.2.3.Xác định các thông số kĩ thuật tương đối của phương pháp PCR so với T 0 phương pháp nuôi cấy ........................................................................................ 58 T 0 3.3.ỨNG DỤNG PHƯƠNG PHÁP PGR ĐỂ KHẢO SÁT TỈ LỆ NHIỄM C. T 0 PERFRINGENS TRÊN MẪU THỰC TẾ ........................................................... 61 T 0 KẾT LUẬN VÀ KIẾN NGHỊ .......................................................................... 63 T 0 T 0 KẾT LUẬN ............................................................................................................. 63 T 0 T 0 KIẾN NGHỊ ............................................................................................................ 64 T 0 T 0 TÀI LIỆU THAM KHẢO ................................................................................ 65 T 0 T 0 CÁC TÀI LIỆU TRONG NƯỚC ......................................................................... 65 T 0 T 0 CÁC TÀI LIỆU NƯỚC NGOÀI........................................................................... 65 T 0 T 0 8 MỞ ĐẦU Trong nền kinh tế xã hội phát triển như hiện nay, đời sống vật chất và tinh thần của người dân được nâng cao. Điều này kéo theo các yêu cầu về chất lượng và vệ sinh thực phẩm cũng khắt khe hơn. Người tiêu dùng không chỉ đòi hỏi cao về chất lượng dinh dưỡng, cảm quan của thực phẩm mà còn về mức độ an toàn vệ sinh của thực phẩm đó. Tuy nhiên, thực tế cho thấy tình trạng ngộ độc thực phẩm trong những năm gần đây lại xảy ra khá nhiều, chủ yếu là các vụ ngộ độc tập thể ở các công ty, xí nghiệp, trường học, khu chế xuất., gây không ít hoang mang đối với người tiêu dùng. Trong số các tác nhân gây ngộ độc thực phẩm, vi sinh vật thường chiếm tỉ lệ gây ngộ độc cao nên việc kiểm nghiệm chúng trong thực phẩm rất được quan tâm. Vì vậy, vấn đề cấp bách hiện nay là cần phải có các phương pháp kiểm nghiệm thực phẩm hữu hiệu hơn nhằm ngăn ngừa tình trạng ngộ độc hoặc có thể giảm các ca ngộ độc đến mức thấp nhất. Ngoài ra cũng cần có các phương pháp xét nghiệm tìm nguyên nhân gây ngộ độc để có biện pháp điều trị kịp thời. Để đáp ứng các nhu cầu trên, nhiều phương pháp kiểm nghiệm nhanh có thể tự động hóa đang từng bước được phát triển và phổ biến rộng như: phương pháp phân tích miễn dịch (ELISA, IMS...), phương pháp PCR, phương pháp sử dụng mẫu dò, phương pháp phát hiện dựa ữên kĩ thuật phát quang sinh học [4]. Góp phần vào việc nghiên cứu các quá trình phát hiện nhanh mầm bệnh vi sinh có trong thực phẩm, Trung tâm Khoa học và Công nghệ cùng với Phòng thí nghiệm Công nghệ Sinh học phân tử Trường Đại học Khoa học tự nhiên, Đại học Quốc gia TP Hồ Chí Minh đã tiến hành các quy trình khảo sát phát hiện E. coli, Salonella, Vibrio, Staphylococcus aureuSy Shigella trong thực phẩm. Hiện nay, chúng tôi tiếp tục hướng nghiên cứu này trong việc khảo sát quy trình phát hiện Clostridium perfringens gây bệnh trong thực phẩm bằng phương pháp PCR. Ngộ độc thực phẩm do C. perfringens gây ra tuy không nguy hiểm như ngộ độc thịt nhưng lại xảy ra khá phổ biến, đặc biệt tại những nước phát triển như Mỹ, Phần Lan. Tại Mỹ, C. perfringens là tác nhân thường xuyên gây ngộ độc thực phẩm và được xếp vào hàng thứ ba sau Salmonella spp và Staphylococcus aureus. Tại Phần Lan, số vụ ngộ độc do C. perfringens gây ra chiếm 20% trong tổng số ca ngộ độc 9 thống kê từ năm 1975 đến năm 1999 [12]. Các trường hợp ngộ độc do C. perfringens gây ra phần lớn có liên quan đến các loại đồ hộp, là những sản phẩm tạo điều kiện kị khí và là môi trường thuận lợi cho vi khuẩn này phát triển và sinh độc tố. Vì vậy, trong các chỉ tiêu vi sinh đối với thực phẩm đóng chai, đóng hộp đều không cho phép sự hiện diện của loại vi khuẩn này. Từ trước đến nay, ở nước ta việc phát hiện C. perfringens trong thực phẩm vẫn thường dựa trên các phương pháp nuôi cấy vi sinh, sinh hóa truyền thống. Các phương pháp này tuy có độ ổn định cao nhưng hạn chế về mặt thời gian, tốn công lao động nên có thể làm tăng chi phí sản xuất, tồn đọng hàng hóa... Do những hạn chế đó, việc phát hiện nhanh, nhạy và chính xác vi khuẩn này trong thực phẩm là hết sức cần thiết và quan trọng. Với sự phát triển nhanh chóng của các kĩ thuật sinh học phân tử nhiều phương pháp phát hiện nhanh vi sinh vật trong thực phẩm đã được thiết lập. Các phương pháp phân tích mới đều có xu hướng rút ngắn thời gian phân tích, tăng độ nhạy, độ đặc hiệu, giảm bớt công lao động, có thể thay thế phương pháp truyền thống trong việc phát hiện và đánh giá mức độ an toàn vi sinh của thực phẩm. Tuy nhiên, những phương pháp mới này vẫn còn một số nhược điểiĩí nhất định, chưa đạt được tất cả các yêu cầu trên, vì thế chúng chưa đưf c phổ biến rộng rãi. Trong đó, phương pháp PCR (Polymerase Chain Reaction) được xem là phương pháp có nhiều ưu điểm nhất. Có rất nhiều nghiên cứu trong và ngoài nước đã và đang cố gắng thiết lập và hoàn thiệa qui trình phát hiện vi sinh vật gây bệnh trong thực phẩm bằng kĩ thuật PGR, nhưtig cho đến nay những phương pháp này vẫn chưa được ứng dụng lịộng rãi và chưa được xem như phương pháp chính thức sử dụng để xét Nghiệm C. perfringens trong hệ thống phân tích đo lường. Để một phương pháp mới trở thành có giá trị và được sử dụng rộng rãi thì phương pháp nậy cần được xác nhận hiệu lực. Do đó, mục tiêu của đề tài luận văn này là thiết lập qui trình phát hiện C. perfringens trong thực phẩm bằng kĩ thuật PCR nhằm khắc phục hạn chế của phương pháp tỊruyền thống đồng thời xác nhận hiệu lực sơ bộ phương pháp này tạo cơ sộ cho bước xác nhận hiệu lực thứ cấp để đưa phương pháp này trở thành phương pháp chính thức cho việc xét nghiệm C. perfringens trong thực phẩm. 10 CHƯƠNG 1: TỔNG QUAN 1.1.NGỘ ĐỘC THỰC PHẨM Ngộ độc thực phẩm là khái niệm chung để chỉ các triệu chứng gây ra do sử dụng thực phẩm bị nhiễm khuẩn, virut, chất độc từ môi trường hoặc chất độc tự nhiên có trong bản thân thực phẩm [15]. Ngộ độc thực phẩm thường xảy ra ở nhiều người, gây ra những triệu chứng giống nhau sau khi tiêu thụ thực phẩm. Tuy nhiên, mức độ tác động sẽ khác nhau tùy thuộc vào khả năng đáp ứng với độc tố và thể trạng khác nhau của từng người. Các triệu chứng thường gặp của ngộ độc thực phẩm là tiêu chảy, chóng mặt, nôn mửa, đau nhức người, sốt và đau đầu. Những triệu chứng này có thể thay đổi tùy vào tác nhân gây ngộ độc là tế bào hay độc tố của vi khuẩn [4]. 1.2.KHÁI QUÁT VỀ GIỐNG CLOSTRIDIUM 1.2.1.Đặc điểm chung [4], [20] Giống Clostridium là các vi khuẩn Gram dương, hình que, kị khí, sinh bào tử, phân bố khắp mọi nơi trong tự nhiên như đất, rác, thực vật, trong đường ruột của người và động vật. Các vi khuẩn này là loài kị khí không bắt buộc, không có superoxide dismutase, peroxidase và catalase. Clostridium là các tác nhân gây ngộ độc thực phẩm nguy hiểm ở người. Hai loài liên quan đến ngộ độc thực phẩm là Clostridium perfringens nhóm A, là tác nhân gây ngộ độc thực phẩm thường xuyên hơn loài C. botulinum, là loài ít gây ra những vụ ngộ độc nhưng hậu quả nghiêm trọng hơn [10]. Các chủng Clostridium đều có khả năng thủy giải saccharide và protein trong các hoạt động thu lấy năng lượng. Những chủng có khả năng thủy giải saccharide có khả năng lên men các loại đường tạo axit hữu cơ và rượu. Chủng có khả năng phân giải protein sẽ chuyển hóa không hoàn toàn các axit amin tạo ra mùi khố chịu. Clostridium thường được phân loại dựa vào hình dạng tế bào, vị trí bào tử và các đặc điểm sinh lí như: 11 - Tế bào có dạng hình que thẳng hay hơi cong với hai đầu tròn, thon hay tù. - Bào tử hình bầu dục, hình tròn, nằm ở giữa, cuối hay gần cuối tế bào. - Chủng Clostridium thuộc nhóm ưa lạnh, ưa nhiệt vừa hoặc ưa nhiệt. 1.2.2.Các tác hại do Clostridium [4], [17] Clostridium vừa là tác nhân gây hư hỏng thực phẩm vừa là tác nhân gây bệnh cho người và động vật. Do phân bố rộng rãi cho nên vi khuẩn dễ xâm nhiễm vào thức ăn và dễ gây ra ngộ độc. Các loại thức ăn đã nấu chín, thức ăn còn thừa khi ăn không được đun lại, thức ăn nguội là nguyên nhân chủ yếu gây ra ngộ độc thực phẩm do Clostridium. Clostridium thường nhiễm vào các loại thực phẩm giàu dinh dưỡng như thịt, sữa, cá... làm cho thực phẩm có màu đen và gây ra mùi khó chịu. Ngoài ra, trong quá trình tăng trưởng, vi khuẩn tạo và tiết ra độc tố gây độc cho người. Ví dụ, C. botulinum gây ngộ độc thịt, C. perfringens gây hoại thư sinh hơi và nhiễm độc thực phẩm. Hiện nay, Clostridium là nhóm vi khuẩn kị khí gây bệnh được nghiên cứu nhiều nhất. Trong hầu hết các trường hợp, Clostridium đều là tác nhân gây bệnh cơ hội, chúng thường gây bệnh khi đã có các vi khuẩn khác xâm nhiễm mở đường. 1.3.ĐẶC ĐIỂM SINH HỌC CỦA CLOSTRIDIUM PERFRINGENS 1.3.1.Lịch sử phát hiện [2], [10] Vào cuối những năm 1890, hai nhà khoa học F.w Andrewes và E. Klein đã phát hiện ra vi khuẩn Clostridium welchii (hiện nay được gọi là Clostridium perfringens) trong thức ăn gây đau bụng và tiêu chảy nhẹ cho người. Năm 1892 người ta phát hiện C. perfringens gây bệnh hoại thư sinh hơi, viêm ruột và sốt hậu sản. Năm 1933 nghiên cứu của Hobbs cho rằng ăn thực phẩm nhiễm C. perfringens có thể dẫn đến ngộ độc thực phẩm. Năm 1948 có nhiều trường hợp tử vong do viêm ruột và dạ dày xảy ra ở Đức có liên quan đến C. perfringens nhóm C. 12 Cuối những năm 1960 và 1970 đã có đầy đủ thông tin để nhận định về ngộ độc C. Perfringens. 1.3.2.Đặc điểm sinh họcình thái sinh tí tế bào [l1] [2] C. perfringens là trực khuẩn Gram (+), có vỏ, sinh bào tử, không có tiên mao, kích thước khoảng 0,8 – 1x4 - 8µm. (Hình 1) C. perfringens thuộc loại vi khuẩn ôn nhiệt có nhiệt độ phát triển tối ưu là 37 45°c. Ở nhiệt độ 45°c thời gian thế hệ (thời gian nhân đôi) là 7 - 9 phút. Do đó, C. perfringens được xem là vi khuẩn có tốc độ sinh trưởng nhanh nhất trong các loài vi sinh vật. Tuy nhiên, chúng không thể tăng trưởng trong môi trường có nồng độ muối NaCl từ 6 - 8% hoặc nhiệt độ nuôi cấy thấp hơn 12°C.Đặc điểm nuôi cấy [1] C. perfringens là loài vi khuẩn kị khí nhưng không đòi hỏi điều kiện kị khí nghiêm ngặt như các loài Clostridium khác. Vì vậy, một số chủng C. perfringens vẫn có khả năng phát triển trong môi trường có ít ôxi. Nhiệt độ nuôi cấy thích hợp là 37°C, pH khoảng 6-7,5. Khi được nuôi cấy trên môi trường rắn, C. perfringens tạo khuẩn lạc tròn, nhẩn ướt. Trong môi trường thạch sâu, khuẩn lạc của C. perfringens có hình hơi ườn hoặc bầu dục. Trong môi trường lỏng, trực khuẩn mọc nhanh làm đục đều môi trường và sinh bọt khí. Trên môi trường thạch máu, xung quanh khuẩn lạc có vòng tan máu. 13Đặc điểm sinh hóa [8], [9] C. perfringens có khả năng lên men các loại đường như glucose, lactose, saccharose, làm đông tụ sữa, làm tan gelatin do chúng sản sinh enzym gelatinase, tinh bột và glycogen. Trong quá trình tăng trưởng trực khuẩn sinh khí H2S và các khí có mùi hôi khác. Ngoài ra, C. perfringens còn có khả năng khử nitrate thành nitrite.ân loại [10], [16] C. perfringens có khả năng tiết ra khoảng 20 loại độc tố, trong đó có 4 độc tố chính là alpha, beta, epsilon, iota. Dựa vào các loại độc tố chính được tạo ra, người ta xếp C. perfringens thành 5 nhóm là C. Perfringens nhóm A, B, c, D và E (Bảngl). Trong đó, C. perfringens nhóm A hiện diện phổ biến nhất trong môi trường và là tác nhân chính gây ra ngộ độc thực phẩm. C. perfringens nhóm C gây hoại tử ruột non. Ngộ độc thực phẩm do C. perfringens nhóm C gây ra rất độc nhưng hiếm xảy ra. Ở một số chủng C. perfringens, gen tạo độc tố nằm trên nhiễm sắc thể, một số chủng khác gen này lại nằm trên plasmid của vi khuẩn. Gen plc tạo độc tố alpha phospholipase c ở cả 5 nhóm C. perfringens đều nằm trên nhiễm sắc thể có trình tự ATAGATACTCCATATCATCCTGCTAATGTTACTGCCGTTGATAGCGCAGGA CATGTTAAGTTTGAAACTTTTGCAGAGGAAAGAAAAGAACAGTATAAAAT AAACACAGCAGGTTGCAAAACTAATGAGGATTTTTATGCTGATATGTTAA AAAACAAAGATTTTAATGCATGGTCAAAAGAATATGCAAGAGGTTTTGCT AAAACTAGGGAAATCAATATACTATAGTCATGCTAGCAT. Gen này mã hóa cho một protein có 398 axit amin. Gen mã hóa độc tố đường ruột (enterotoxin) của C. perfringens có thể nằm ữên nhiễm sắc thể hay trên plasmid. Ở các chủng C. perfringens gây ngộ độc thực phẩm cho người thì gen tạo độc tố đường ruột nằm trên nhiễm sắc thể, trong khi đó ở các chủng C. perfringens gây bệnh ở động vật thì gen này lại nằm trên plasmid. Độc tố đường ruột là một protein có 391 axit amin và được hình thành trong quá trình tạo bào tử của vi khuẩn. 14 1.4.NGỘ ĐỘC THỰC PHẨM DO C. PERERINGENS 1.4.1. Nguyên nhân và triệu chứng ngộ độc thực phẩm do C. perfringens [5], [9] C. perfringens còn có biệt danh là "vi khuẩn quán ăn" vì hầu hết các vụ ngộ độc do vi khuẩn này gây ra thường liên quan đến thức ăn hàng quán, căn tin đã được chế biến trước đó hàng giờ và không được bảo quản đúng cách. Vi khuẩn C. perfringens có thể tồn tại dưới dạng tế bào sinh dưỡng hay bào tử. Khi thức ăn được đun chín, các tế bào sinh dưỡng có thể chết đi nhưng bào tử của chúng vẫn còn sống sót. Khi nhiệt độ trở nên thuận lợi, bào tử nảy mầm thành tế bào sinh dưỡng tăng trưởng và tạo ra độc tố gây ngộ độc. Các trường hợp ngộ độc thực phẩm xảy ra đều do c. perýringens nhóm A, một vài trường hợp đo C. perfringens nhóm c gây ra. Ngộ độc thực phẩm do C. perfringens nhóm A được gây ra bởi độc tố đường ruột mà vi khuẩn này tiết ra trong quá dinh hình thành bào tử ở màng ruột. Bào tử của c. perfringens có thể nhiễm vào thịt tươi, rau sống. Việc đun nấu thức ăn bình thường không diệt được bào tử của vi khuẩn. Khi thức ăn này được để nguội một thời gian đủ dài trong điều kiện không được bảo quản lạnh, bào tử của vi khuẩn bắt đầu tăng trưởng. Nếu thức ăn không được đun nóng lại trước khi ăn thì các tế bào sinh dưỡng của C. perfringens sẽ theo thực phẩm vào ruột non, tạo độc tố và gây ngộ 15 độc. Các triệu chứng do C. perfringens nhóm A gây ra thường là tiêu chảy, đau thắt vùng bụng trong vòng 8-24 giờ sau khi ăn phải thực phẩm bị nhiễm khuẩn. ít có trường hợp bị sốt, buồn nôn hay ói mửa. Bệnh thường chấm dứt sau 2-3 ngày và không gây tử vong. C. perfringens nhóm c gây ra triệu chứng của bênh ở một non như! nôn mửa, đau bụng và tiêu chảy ra máu. Khi mật độ vi khuẩn lên đến l06 tế bào/g thực phẩm, P P bệnh thường dẫn đến tử vong do hậu quả của triệu chứng viêm ruột và nhiễm trùng máu. Độc tố đường ruột của C. perfringens được hoạt hóa nhanh trong ruột gây ra hiện tượng hoại thư sinh hơi gây mất nước trong ruột non. Độc tố tác động lên tế bào biểu mô gây đau bụng cấp tính và nôn mửa trong 8-16 giờ. 1.4.2.Độc tố đường ruột của C. perfringens [9], [11] Độc tố đường ruột của C. perfringens (CPE - C. perfringens enterotoxin) rít nhạy với nhiệt độ và pH nên dễ bị phân hủy ở nhiệt độ 60°C trong vòng 5 phút hay bị mất hoạt tính do pH thấp ở dạ dày. Tuy nhiên, độc tố này lại được tạo ra nhanh chóng ồ ruột non nhờ môi trường pH thuận lợi. Độc tố đường ruột được vi khuẩn C. perfringens tiết ra sau khi bào tử được hình thành 10-12 giờ. Về mặt cấu trúc phân tử, CPE là một polypeptid mạch đơn có trọng lượng phân tử gần bằng 3,5kDa, bao gồm 319 axit amin có điểm đẳng điện là 4,3. Độc tố được chia làm 3 vùng (Hình 2): - Đầu C: có nhiệm vụ gắn kết vào các thụ thể trên màng tế bào. - Vùng giữa: mang độc tính. - Đầu N: vẫn chưa rõ hoạt tính. 16 Sau khi được tạo ra ở ruột non, đầu C của độc tố sẽ gắn vào các thụ thể protein trên màng tế bào ruột và tạo thành một phức hợp giữ chặt CPE trên bề mặt màng tế bào. Phức hợp này sẽ thay đổi cấu hình liên kết với một protein màng khác có trọng lượng 70 kDa tạo thành phức hợp lớn kị nước. Phức hợp lớn hình thành các cấu trúc lỗ màng làm gia tăng tính thấm của màng. Điều này dẫn đến hậu quả là các phân tử nhỏ trong tế bào chất bị thoát ra ngoài gây gián đoạn nhanh chóng quá trình trao đổi chất bên trong tế bào. Mặt khác, do sự mất cân bằng trong tính thấm của tế bào, nước vào trong tế bào nhiều hơn gây ra hiện tượng vỡ tế bào (Hình 3). 1.4.3.Các chỉ tiêu về c. perfringens trong thực phẩm [4] Giới hạn cho phép của C. perfringens trong thực phẩm được qui định bởi Bộ Y tế (Bảng 2). Bảng này cho thấy, việc cho phép sự hiện diện của vi khuẩn C. 17 perfringens trong một số mặt hàng thực phẩm là rất thấp và thậm chí không cho phép sự hiện diện của vi khuẩn này. Bảng 2. Tiêu chuẩn C. perfringens cho phép trong thực phẩm, Bộ Y tế 4/1998 18 1.5.CÁC PHƯƠNG PHÁP PHÁT HIỆN C.PERFRINGENS TRONG THỰC PHẨM 1.5.1.Phương pháp nuôi cấy [4], [8] Các phương pháp nuôi cấy truyền thống để xét nghiệm C. perfringens được xây dựng dựa trên những đặc điểm về vi sinh, sinh hóa của vi khuẩn và gồm một số bước như sau: - Nuôi cấy và phân lập Mẫu thực phẩm được đồng nhất và dịch đồng nhất được pha loãng đến nồng độ thích hợp. cấy 0,1 ml dịch pha loãng vào môi trường thạch sâu Iron Sulfite Agar (ISA) (hay trải, ria trên đĩa petri). Đổ thêm lên bề mặt một lớp môi trường ISA. Ủ kị khí ở 37°C trong 24 giờ. Trên môi trường ISA, khuẩn lạc đặc trưng của C. perfringens s sẽ có màu đen, hình tròn. Tuy nhiên, một số chủng Clostrdium khác cũng tạo khuẩn lạc có đặc điểm tương tự nên cần phải qua bước khẳng định sinh hóa. - Kiểm tra khẳng định sơ bộ Cấy một khuẩn lạc đặc trưng của C. perfringens trên môi trường ISA sang môi trường thioglycolate broth. Ủ ở 37°C trong 24 giờ, sau đó tiến hành nhuộm gram và quan sát hình thái tế bào dưới lánh hiển vi. Chuyển 1ml dịch nuôi cấy từ môi trường thioglycolate broth sang môi trường iron-milk ở 46°C. Sau 2 giờ cấy, cứ cách mỗi giờ kiểm tra sự lên men ữong môi trường. - Kiểm tra khẳng định: thử phản ứng sinh hóa trên các môi trường motilitynitrate và lactose-gelatin, thử hoạt tính catalase và khả năng di động để có kết luận cuối cùng là C. perfringens. Đây là trực khuẩn Gram dương, không di động, tạo khuẩn lạc màu đen trên môi trường ISA, khử nitrate thành nitrite, cho thử nghiệm catalase âm tính, lên men lactose sinh axit và hơi, làm tan gelatin. Có thể sử dụng cơ chất MÚP (Methylumbelliferylphosphate) để bổ sung thêm vào môi trường ISA trong bước nuôi cấy phân lập để khẳng định C. perfringens mà không cần qua bước khẳng định sinh hóa. MUP là cơ chất của phosphatase là chất chỉ 19 thị đác trưng đối với C. perfringens. Phosphatase sẽ phân cắt MUP tạo thành 4 methylumbelliferone và chất này sẽ phát huỳnh quang dưới đèn UV. 1.5.2.Phương pháp ELISA (Enzyme - Linkeđ Immunosorbent Assay) [18,19] Phương pháp ELISA cho phép phát hiện được 5 độc tố quan trọng của C. perfringens là alpha, beta, epsilon, iota và độc tố đường ruột. Nguyên tắc của phương pháp là sử dụng một kháng thể đơn dòng liên kết đặc trưng Với độc tố của tế bào vi khuẩn. 1.5.3 Phương pháp PCR (Polymerase chain reaction) [6], [7] Việc phát hiện C. perfringens trong thực phẩm thường tập trung vào phát hiện gen tạo độc tố đường ruột vì đây là tác nhân chính của các vụ ngộ độc thực phẩm. Năm 1997, Patrick Fach và Michel R. Popoff đã thành công trong việc phát hiện vi khuẩn C. perfringens tạo độc tố đường ruột trong thực phẩm bằng kĩ thuật PCR. 'Trong phần nghiên cứu này, tác giả đã sử dụng đồng thời hai cặp mồi (PL3, PL7) và (P145, P146) để phát hiện sự hiện diện của hai gen pỉc mã hóa cho độc tố alpha phospholipase C và gen cpe mã hóa cho độc tố đường ruột. Cả hai gen này đều nằm trên nhiễm sắc thể của vi khuẩn C. Perfringens. 1.5.4.So sánh ưu nhược điểm của các phương pháp Phương pháp truyền thống phát hiện C. perfringens trong thực phẩm gặp nhiều giới hạn về thời gian, cần 3-5 ngày. Phương pháp ELISA thường cho kết quả nhanh và độ nhạy cao trong các trường hợp xét nghiệm độc tố đã có sấn trong mẫu thực phẩm. Tuy nhiên, hạn chế của phương pháp này là đòi hỏi độ tinh sạch của mẫu cao nhằm tránh sự ức chế bởi các protein ữong thực phẩm. Mặt khác, mẫu cần nguyên vẹn, không bị biến tính để tránh trường hợp cho kết quả âm tính giả. Trong phương pháp này, mẫu cần được tăng sinh trong môi trường và điều kiện đặc biệt để chủng hình thành bào tử và tạo độc tố. Điều này làm giảm hiệu quả sử dụng của phương pháp. Trong khi đó, các phương pháp phát hiện C. perfringens dựa trên kĩ thuật sinh học phân tử thường có độ nhạy và độ đặc hiệu cao. Mặc dù các phương pháp này vẫn đòi hỏi bước tăng sinh để tăng mật độ tế bào của vi khuẩn nhưhg phương pháp này 20
- Xem thêm -