Tài liệu ứng dụng kỹ thuật pcr phát hiện nhanh tụ cầu vàng staphylococcus aureus.

  • Số trang: 34 |
  • Loại file: PDF |
  • Lượt xem: 623 |
  • Lượt tải: 0
dangvantuan

Tham gia: 02/08/2015

Mô tả:

TRƯỜNG ĐẠI HỌC NÔNG LÂM THÁI NGUYÊN KHOA CNSH-CNTP BÁO CÁO KẾT QUẢ ĐỀ TÀI NGHIÊN CỨU KHOA HỌC CẤP TRƯỜNG MÃ SỐ: T2013 – 12 TÊN ĐỀ TÀI: ỨNG DỤNG KỸ THUẬT PCR PHÁT HIỆN NHANH TỤ CẦU VÀNG Staphylococcus aureus CHỦ TRÌ ĐỀ TÀI: Nguyễn Văn Duy Thái Nguyên – 2014 LỜI CAM ĐOAN Tôi xin cam đoan đây là đề tài nghiên cứu do trực tiếp nhóm nghiên cứu thực hiện tại Phòng thí nghiệm Sinh học phân tử - Kỹ thuật di truyền, Khoa Công nghệ Sinh học và Công nghệ Thực phẩm trường Đại học Nông Lâm Thái Nguyên. Đề tài nghiên cứu được thực hiện trên các thiết bị hiện đại, phù hợp với nội dung và mục tiêu nghiên cứu đề ra và phù hợp với lĩnh vực nghiên cứu của đề tài. Do đó, các kết quả nghiên cứu thu được hoàn toàn chính xác, trung thực và đủ tin cậy. Các kết quả nghiên cứu được công bố trong báo cáo này đã được sự đồng ý của các thành viên trong nhóm nghiên cứu. Thái Nguyên, ngày 02 tháng 03 năm 2014 Chủ nhiệm đề tài Nguyễn Văn Duy LỜI CẢM ƠN Để hoàn thành đề tài này, trước hết tôi xin trân trọng cảm ơn Ban Giám hiệu, phòng Quản lý Khoa học và Quan hệ Quốc tế, Ban Chủ nhiệm khoa CNSH-CNTP đã tạo điều kiện thuận lợi cho tôi thực hiện và hoàn thành nghiên cứu này. Tôi xin trân trọng cảm ơn TS. Lê Quang Hòa, Viện Công nghệ Sinh học và Công nghệ Thực phẩm, Trường Đại học Bách Khoa Hà Nội, TS. Nguyễn Đắc Trung, khoa Cơ sở, Trường Đại học Y – Dược Thái Nguyên, ThS. Đỗ Bích Duệ, cán bộ Viện Khoa học Sự sống, Trường Đại học Nông Lâm Thái Nguyên đã cung cấp chủng vi sinh vật để chúng tôi tiến hành các nghiên cứu trong đề tài này. Tôi xin cám ơn các thành viên của nhóm nghiên cứu đã giúp tôi hoàn thành các nội dung nghiên cứu trong đề tài này. Xin trân trọng cảm ơn! Thái Nguyên, ngày 02 tháng 03 năm 2014 Chủ nhiệm đề tài Nguyễn Văn Duy DANH MỤC CÁC HÌNH Tên hình Trang Hình 2.1: Vi khuẩn Staphylococcus aureus 6 Hình 2.2. Các bước thực hiện một chu kỳ phản ứng PCR 11 Hình 4.1. Trình tự nucleotide của cặp mồi NucF- NucR 18 Hình 4.2. Hình ảnh điện di kiểm tra sản phẩm tách chiết DNA 19 Hình 4.3. Kết quả khuếch đại vùng gen đặc hiệu của Staphylococcus aureus bằng phản ứng PCR sử dụng sản phẩm DNA tách chiết được bằng hóa chất 20 Hình 4.4. Kết quả điện di kiểm tra sản phẩm PCR sử dụng 20 các nồng độ khuôn DNA khác nhau Hình 4.5. Kết quả điện di kiểm tra sản phẩm PCR 21 ở các nhiệt độ gắn mồi và nồng độ MgCl2 khác nhau Hình 4.6. Kết quả điện di kiểm tra sản phẩm PCR sử dụng khuôn DNA tách chiết từ các loài vi khuẩn kiểm định 23 TÓM TẮT KẾT QUẢ NGHIÊN CỨU ĐỀ TÀI KHOA HỌC VÀ CÔNG NGHỆ CẤP CƠ SỞ - Tên đề tài: “Ứng dụng kỹ thuật PCR phát hiện nhanh tụ cầu vàng Staphylococcus aureus” - Mã số: T2013 – 12. - Chủ nhiệm đề tài: Nguyễn Văn Duy - Điện thoại: 0915384836 Email: duynguyenvan_1978@yahoo.com.vn - Cơ quan chỉ chì đề tài: Trường Đại học Nông Lâm Thái Nguyên - Cá nhân phối hợp thực hiện: + SV. Đinh Thị Hoa, lớp 41 CNSH; Khoa CNSH-CNTP, Trường Đại học Nông Lâm Thái Nguyên + SV. Nguyễn Anh Tuấn, lớp 43 CNSH, Khoa CNSH-CNTP, Trường Đại học Nông Lâm Thái Nguyên - Thời gian thực hiện: Tháng 3/2013-3/2014 1. Mục tiêu Xây dựng được quy trình kỹ thuật PCR phát hiện nhanh Staphylococcus aureus có độ nhạy và độ đặc hiệu cao 2. Nội dung chính - Nội dung 1. Thiết kế cặp mồi cho phản ứng PCR - Nội dung 2. Tối ưu các điều kiện của phản ứng PCR - Nội dung 3. Xác định độ đặc hiệu của phản ứng PCR 3. Kết quả chính đạt được - Sản phẩm đào tạo: 01 kỹ sư Công nghệ Sinh học - Sản phẩm khoa học: 01 báo cáo đề tài nghiên cứu khoa học - Sản phẩm ứng dụng: + 01 cặp mồi đặc hiệu cho phản ứng PCR phát hiện nhanh vi khuẩn tụ cầu vàng Staphylococcus aureus + 01 Quy trình phát hiện nhanh tụ cầu vàng Staphylococcus aureus ở mức độ chủng thuần trong phòng thí nghiệm. SUMMARY - Research Project Title: “Application of PCR technique for rapid detection of Staphylococcus aureus” - Code number: T2013-12 - Coordinator: Nguyen Van Duy - Tel: 0915384836 - Implementing Institution: Thai Nguyen University of Agriculture and Foresrtry - - Cooperating Institution(s): Email: duynguyenvan_1978@yahoo.com.vn + Dinh Kim Hoa, Class of 41st CNSH, Faculty of Biotechnology and Food technology, Thai Nguyen University of Agriculture and forestry + Nguyen Tuan Anh, Class of 43rd CNSH, Faculty of Biotechnology and Food technology, Thai Nguyen University of Agriculture and forestry - Duration: from 3/2013 to 3/2014 1. Objectives Constructing PCR process for rapid detection of Staphylococcus aureus with high sensitivity and high specificity 2. Main contents - Designing a pair of primer for PCR reaction. - Optimizing conditions of PCR reaction - Determining the Specificity of detection of the PCR reaction. 3. Obtained Results - Trained Results: 01 engineer on Biotechnology - Scientific Results: 01 Scientific researched Report - Applied Results: + A pair of specific primer for PCR reaction for rapid detection of Staphylococcus aureus. + 01 PCR process for rapid detection of Strains of Staphylococcus aureus in laboratory level MỤC LỤC MỤC LỤC ....................................................................................................................... 1 Phần 1 MỞ ĐẦU ............................................................................................................. 3 1.1. Đặt vấn đề ............................................................................................................. 3 1.2. Mục đích và yêu cầu của nghiên cứu ..................................................................... 4 1.2.1. Mục đích nghiên cứu ..................................................................................... 4 1.2.2. Yêu cầu nghiên cứu ....................................................................................... 4 1.3. Ý nghĩa của nghiên cứu......................................................................................... 4 1.3.1. Ý nghĩa khoa học ........................................................................................... 4 1.3.2. Ý nghĩa thực tiễn............................................................................................ 4 Phần 2 TỔNG QUAN TÀI LIỆU ..................................................................................... 5 2.1. Tình hình ngộ độc do Staphylococcus aureus trong và ngoài nước........................ 5 2.1.1. Tình hình trong nước ..................................................................................... 5 2.1.2. Trên thế giới .................................................................................................. 5 2.2. Tổng quan về Staphylococcus aureus .................................................................... 6 2.2.1. Đặc điểm hình thái ......................................................................................... 6 2.2.2. Đặc điểm nuôi cấy và đặc điểm sinh hóa ...................................................... 6 2.3. Phương pháp phát hiện Staphylococcus aureus ..................................................... 7 2.3.1. Phương pháp truyền thống ............................................................................. 7 2.3.2. Phương pháp hiện đại .................................................................................... 8 2.4. Tổng quan về kỹ thuật PCR (Polymerase Chain Reaction) .................................. 10 2.4.1. Khái niệm PCR ............................................................................................ 10 2.4.2. Nguyên tắc của thử nghiệm PCR ................................................................. 10 2.4.3. Thành phần phản ứng................................................................................... 11 2.4.4. Những ưu điểm hạn chế của kỹ thuật PCR ................................................... 12 2.4.5. Ứng dụng của kỹ thuật PCR trong phát hiện nhanh vi sinh vật gây bệnh ...... 13 Phần 3 ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU .................... 14 3.1. Đối tượng và phạm vi nghiên cứu ....................................................................... 14 3.1.1. Đối tượng nghiên cứu .................................................................................. 14 3.3. Vật liệu, thiết bị, hóa chất nghiên cứu ................................................................. 14 3.3.1. Vật liệu ngiên cứu ........................................................................................ 14 3.4. Nội dung nghiên cứu ........................................................................................... 14 3.4.1. Thiết kế cặp mồi cho phản ứng PCR ............................................................ 14 3.4.3. Xây dựng qui trình phát hiện nhanh Staphylococcus aureus bằng kỹ thuật PCR .... 14 3.4.5. Xác định giới hạn phát hiện của phản ứng PCR trong phát hiện nhanh Staphylococcus aureus .................................................................................................................... 14 3.5. Phương pháp nghiên cứu ..................................................................................... 14 1 3.5.1. Phương pháp thiết kế cặp mồi cho phản ứng PCR từ vi khuẩn Staphylococcus aureus.................................................................................................................... 14 3.5.2. Phương pháp tách chiết DNA....................................................................... 15 3.5.3. Xác định điều kiện tối ưu của Phản ứng PCR ............................................... 16 3.5.4. Phương pháp xác định độ đặc hiệu của phản ứng PCR ................................. 16 3.5.5. Phương pháp điện di kiểm tra sản phẩm PCR .............................................. 17 Phần 4 KẾT QUẢ NGHIÊN CỨU ................................................................................. 18 4.1. Thiết kế cặp mồi đặc hiệu cho phản ứng PCR phát hiện nhanh Staphylococcus aureus........................................................................................................................ 18 Trình tự nucleotide của cặp mồi được lựa chọn thể hiện trong bảng 4.1 ......................... 18 4.2. Tối ưu các điều kiện của phản ứng PCR phát hiện nhanh Stapylococcus aureu ... 19 4.2.1. Kết quả điện di kiểm tra sản phẩm tách chiết DNA bằng phương pháp sử dụng hóa chất ........................................................................................................ 19 4.2.2. Kiểm tra DNA tổng số bằng phương pháp PCR ........................................... 19 4.2.3. Xác định nồng độ DNA tối thiểu của phản ứng PCR phát hiện Staphylococcus aureus.................................................................................................................... 20 4.2.4. Tối ưu phản ứng PCR phát hiện nhanh Staphylococcus aureus .................... 21 4.3. Kết quả xác định độ đặc hiệu của phản ứng PCR ................................................ 23 Phần 5 KẾT LUẬN........................................................................................................ 25 5.1. Kết luận .............................................................................................................. 25 5.2. Kiến nghị.............................................................................................................. 25 TÀI LIỆU THAM KHẢO .............................................................................................. 26 2 Phần 1 MỞ ĐẦU 1.1. Đặt vấn đề Ngộ độc thực phẩm (NĐTP) đang là mối quan tâm đặc biệt ở mỗi quốc gia và đang là mối đe dọa nghiêm trọng đến sức khỏe cộng đồng. Nguyên nhân hàng đầu của các ca NĐTP là do sự xuất hiện của các vi sinh vật gây bệnh nhiễm tạp trong mẫu thực phẩm, trong đó tụ cầu vàng Staphyloccocus aureus là một trong số các tác nhân nguy hiểm nhất [8]. Điển hình như vụ ngộ độc tập thể xảy ra trong một đám cưới ngày 12/4/2012 tại bản Hùn, xã Chiềng Cọ, Thành phố Sơn La do thực phẩm nhiễm vi khuẩn Staphylococcus aureus làm hơn 300 người mắc và phải nhập viện cấp cứu. Một vụ ngộ độc tập thể khác xảy ra ngày 16/4/2012 khiến hơn 200 công nhân của Công ty Dream MeKong thuộc xã An Cư, huyện Cái Bè, tỉnh Tiền Giang bị ngộ độc…[4]. Theo WHO/FAO (tháng 5/2005), ngộ độc thực phẩm xảy ra ở nhiều nơi, ảnh hưởng rất lớn đến sức khỏe con người và kinh tế. Vì vậy mà hiện nay đã có nhiều phương pháp được sử dụng để phát hiện vi khuẩn Staphylococcus aureus, phương pháp nuôi cấy truyền thống luôn luôn bao gồm nhiều công đoạn nuôi cấy kết hợp với các bước kiểm tra sinh hóa tốn nhiều thời gian (5- 7 ngày) [13]. Sự phát hiện chậm các vi khuẩn gây bệnh trong mẫu thực phẩm là một trong những nguyên nhân làm tác nhân gây bệnh này có cơ hội lây lan trong cộng đồng, ảnh hưởng đến sức khỏe của con người [8]. Ngày nay với sự tiến bộ của khoa học kỹ thuật, các kỹ thuật sinh học phân tử đã và đang cho phép phát triển những phương pháp kiểm tra rất nhạy và nhanh sự hiện diện của các dòng vi khuẩn, kỹ thuật PCR cũng được áp dụng để chẩn đoán nhanh S. aureus trong thực phẩm có kết quả trong thời gian ngắn [10]. Kỹ thuật phản ứng chuỗi polymerase (Polymerase chain reaction PCR) là một kỹ thuật dùng để khuếch đại các đoạn DNA chuyên biệt bằng cách sử dụng các cặp mồi chuyên biệt. PCR có thể được sử dụng để phát hiện một lượng rất nhỏ của DNA mục tiêu đã bị pha lẫn trong các mẫu DNA khác nhau. PCR có độ nhạy cao, cho phép phát hiện nhanh tác nhân gây bệnh nên đã trở thành công cụ phổ biến trong việc phát hiện nhiều tác nhân gây bệnh trên người, vật nuôi cũng như trong các mẫu thực phẩm [7]. Điều này giúp người làm công tác xét nghiệm có định hướng sớm trong chẩn đoán các trường hợp ngộ độc thực phẩm [14]. Xuất phát từ thực tiễn đời sống, trên cơ sở căn cứ vào năng lực nghiên cứu của Khoa CNSH và CNTP - Đại học Nông Lâm Thái Nguyên - Đại học Thái Nguyên, chúng tôi tiến hành nghiên cứu đề tài: “Ứng dụng kỹ thuật PCR phát hiện nhanh tụ cầu vàng Staphylococcus aureus”. 3 1.2. Mục đích và yêu cầu của nghiên cứu 1.2.1. Mục đích nghiên cứu - Xây dựng được qui trình phát hiện nhanh Staphylococcus aureus dựa trên kỹ thuật PCR. 1.2.2. Yêu cầu nghiên cứu - Thiết kế được cặp mồi đặc hiệu cho phản ứng PCR phát hiện nhanh Staphylococcus aureus - Xây dựng được qui trình tách chiết DNA phù hợp cho phát hiện nhanh Staphylococcus aureus bằng kỹ thuật PCR - Xác định được điều kiện tối ưu của phản ứng PCR phát hiện nhanh Staphylococcus aureus - So sánh được khả năng tách chiết DNA Staphylococcus aureus bằng phương pháp sốc nhiệt và phương pháp hóa chất - Xác định được độ đặc hiệu của phản ứng PCR phát hiện nhanh Staphylococcus aureus trong mẫu thực phẩm 1.3. Ý nghĩa của nghiên cứu 1.3.1. Ý nghĩa khoa học Nghiên cứu phát triển kỹ thuật PCR phát hiện nhanh S. aureus trong mẫu thực phẩm. Tạo tiền đề khoa học cho việc phát triển bộ kít phát hiện nhanh vi khuẩn gây bệnh này trong mẫu thực phẩm. 1.3.2. Ý nghĩa thực tiễn Kết quả nghiên cứu sẽ tạo cơ sở để phát triển bộ kit phát hiện nhanh S. aureus trong mẫu thực phẩm phục vụ công tác giám sát, quản lý chất lượng trong sản xuất chế biến thực phẩm. Xác định nguyên nhân gây ngộ độc thực phẩm hoặc dịch bệnh, giám sát sự lan truyền vi khuẩn gây bệnh trong cộng đồng. 4 Phần 2 TỔNG QUAN TÀI LIỆU 2.1. Tình hình ngộ độc do Staphylococcus aureus trong và ngoài nước 2.1.1. Tình hình trong nước Tuy thời gian gây bệnh ngắn nhưng những vụ ngộ độc thực phẩm do tụ cầu để lại hậu quả không nhỏ. Theo đánh giá của Tổ chức Y tế Thế giới, hàng năm Việt nam có khoảng trên 3 triệu ca ngộc độc thực phẩm, gây tổn hại trên 200 triệu USD. Trong những năm gần đây số vụ ngộc độc thực phẩm ở nước ta ngày càng gia tăng [4]. Năm 2000 có 213 vụ ngộ độc thực phẩm với 4233 người mắc trong đó có 59 người tử vong [3]. Theo số liệu từ Cục Quản lý chất lượng vệ sinh an toàn thực phẩm, trong những vụ dịch được tổng kết từ năm 1997 đến 2006 thì ngộc độc thực phẩm do tác nhân vi sinh vật chiếm tỷ lệ cao (từ 40- 45%) trong các loại gây ngộ độc, trong đó có nhiều vụ được xác định tác nhân là Staphylococcus aureus [7]. Từ năm 2002 đến 2004 theo số liệu của trung tâm y tế dự phòng đã có 77 vụ ngộ độc thực phẩm mà phần lớn nguyên nhân là do thức ăn bị nhiễm khuẩn, chiếm 66% [8]. Trong năm 2005, số vụ ngộ độc thực phẩm ở nước ta là 141 vụ, làm 4291 người bị ngộ độc, trong đó có 73 vụ (51,8%) là do vi sinh vật gây ra (theo số liệu của Cục vệ sinh an toàn thực phẩm, năm 2006) [8]. Qua các cuộc khảo sát tình hình vệ sinh thức ăn đường phố và các thực phẩm chế biến sẵn tại các chợ cho thấy mức độ nhiễm Staphylococcus aureus là rất cao, phù hợp với các kết quả xét nghiệm trong các vụ ngộ độc tại các thành phố lớn trong những năm qua. Đáng chú ý hơn cả là vụ ngộ độc thực phẩm của cán bộ, sinh viên khoa Địa chất và Sinh học trường Đại học Khoa học tự nhiên TP.HCM vào ngày 27/07/2006 trong chuyến đi thực tế và đã ăn trưa tại Nha Trang (Khánh Hòa). Ba giờ chiều cùng ngày, nhiều cán bộ sinh viên đau đầu, tiêu chảy, ói mửa, tất cả 105 người phải vào bệnh viện cấp cứu. Nguyên nhân được xác định là do thức ăn chế biến không hợp vệ sinh, lại để lâu nên đã nhiễm tụ cầu vàng và đã sinh độc tố enterotoxin. Enterotoxin do tụ cầu tạo ra và là loại độc tố cực mạnh gây ngộ độc cấp tính [13]. Mấy năm gần đây, những vụ ngộ độc thức ăn do tụ cầu được phát hiện và nói đến nhiều hơn. Ở Việt Nam, chỉ tính riêng năm 2012, theo số liệu thống kê chưa đầy đủ của Cục ATVSTP từ đầu tháng 4/2012 đến tháng 09/2012, cả nước đã xảy ra 10 vụ ngộ độc thực phẩm làm 972 người mắc, trong đó có 726 người phải nhập viện, đã có 04 trường hợp tử vong. Phần lớn các vụ ngộ độc xảy ra với quy mô nhiều người mắc, nguyên nhân chủ yếu gây ngộ độc là do thực phẩm nhiễm vi sinh vật, trong đó tụ cầu vàng Staphylococcus aureus là một trong những nguyên nhân chính [4]. 2.1.2. Trên thế giới Ngộ độc thực phẩm không chỉ xảy ra ở nước ta mà còn xảy ra ở nhiều nước trên thế giới kể cả những nước phát triển. Theo WHO/FAO (tháng 5/2005), ngộc độc thực phẩm ảnh hưởng rất lớn đến sức khỏe con người và kinh tế, làm 1,5 tỉ lượt người nhiễm 5 bệnh [8]. Mỹ, 1 quốc gia có nền kinh tế và trình độ khoa học phát triển nhất thế giới, trung bình mỗi năm có 76 triệu ca NĐTP với 325.000 người phải vào viện và 5.000 người chết, chi phí cho 1 ca NĐTP mất 1.531 đôla Mỹ (US - FDA, 2006) [29], [21]. Ngoài vấn đề viện phí còn phải mất nhiều thời gian làm việc cũng như sản phẩm lao động của người bệnh và cả việc phải loại bỏ những sản phẩm bị nhiễm…Tại Nhật Bản, vụ NĐTP do sữa tươi giảm béo bị ô nhiễm tụ cầu vàng tháng 7/2000 đã làm cho 14.000 người ở 6 tỉnh bị ngộ độc thực phẩm. Công ty sữa SNOW BRAND phải bồi thường cho 4.000 nạn nhân mỗi người mỗi ngày 20.000 yên [27]. Ở Đài Loan vào tháng 6 năm 2000, vụ ngộ độc thực phẩm do tụ cầu tại một trường trung học ở Taichung County làm 10 trong số 356 học sinh có biểu hiện ngộ độc 2- 3 giờ sau khi ăn sáng [23], [24]. Tại Pháp, năm 1997 người ta tìm thấy S. aureus là tác nhân gây ra 569 trong tổng số 1142 vụ ngộ độc thực phẩm do vi khuẩn. Ngày 17/6/2004, 21 trong tổng số 53 công nhân sau khi ăn trưa tại căn tin công ty ở Shizuoka Prefecter thì có biểu hiện bệnh, trong đó có 8 trường hợp phải nhập biện [20]. 2.2. Tổng quan về Staphylococcus aureus 2.2.1. Đặc điểm hình thái Staphylococcus aureus (còn được gọi là tụ cầu vàng) có dạng hình cầu, Gram(+), đường kính 0,8 - 1µm và đứng thành hình chùm nho, hình thức tập hợp này do vi khuẩn phân bào theo nhiều chiều trong không gian. Trong bệnh phẩm, vi khuẩn thường thường họp lại từng đôi một hay tạo thành những đám nhỏ. S. aureus không di động, không có lông, không sinh nha bào và thường không có vỏ. Trên môi trường canh S. aureus có thể hình chuỗi ngắn, khi canh trường già hơn 24 giờ nó có thể bắt màu Gram (-) [13]. Hình 2.1: Vi khuẩn Staphylococcus aureus (Nguån: http://www.khoahoc.com.vn) 2.2.2. Đặc điểm nuôi cấy và đặc điểm sinh hóa Staphylococcus aureus mọc dễ trên nhiều loại môi trường nuôi cấy vi khuẩn ở điều kiện hiếu khí và kỵ khí tùy nghi. Nhiệt độ thích hợp để S. aureus tiết ra sắc tố là 37oC nhưng ở nhiệt độ phòng 20 - 25oC là tốt nhất [13]. 6 Trên môi trường thạch dinh dưỡng: S. aureus tạo khuẩn lạc tròn ướt, lồi màu vàng. Trên môi trường Chapman agar: tạo khuẩn lạc vàng và môi trường chuyển từ hồng sang vàng. Trên môi trường Baird Parker (BP): tạo khuẩn lạc đen, quanh khóm có vòng sáng. Trên môi trường thạch máu: gây dung huyết, khuẩn lạc tròn nhẵn, đường kính 1- 3 mm, hình thành sắc tố trắng đến hơi vàng [13]. Staphylococcus aureus lên men đường manitol glucose, lactose không lên men glyxerin cho phản ứng Indol âm tính, Methyl Red dương tính, Voges - Proskauer dương tính, chuyển Nitrate thành Nitrite, không sinh H2S, catalase dương, coagulase dương [6]. 2.3. Phương pháp phát hiện Staphylococcus aureus 2.3.1. Phương pháp truyền thống Staphylococcus aureus được xác định dựa trên cơ sở các đặc điểm tăng trưởng và phản ứng huyết tương của các dòng thuần từ các khuẩn lạc đặc trưng trên môi trường phân lập. 2.3.1.1. Phương pháp định tính Cho dung dịch mẫu vào môi trường TSB, ủ 37oC trong 24 giờ, sau đó cấy ria lên môi trường thạch BP (Baird Paker), ủ 37oC trong 48 giờ. Tìm khuẩn lạc đặc trưng của S. aureus trên môi trường BP có màu đen nhánh, sáng, tròn, lồi, đường kính 1- 1,5mm, có vòng sáng xung quanh khuẩn lạc để cấy sang môi trường BHI (Brain Heart Infusion), ủ 37oC trong 24 giờ. Sau đó cấy sang ống nghiệm nhỏ có chứa 0,3ml huyết tương để thử phản ứng đông kết (phản ứng coagulase), thực hiện song song một ống đối chứng không được cấy vi sinh vật, theo dõi kết quả đông huyết tương sau các khoảng thời gian 2, 4, 6, 8 và 24 giờ. Mẫu được kết luận là có S. aureus khi thử nghiệm coagulase dương tính [16]. 2.3.1.2. Phương pháp đếm khuẩn lạc Nguyên tắc: Phương pháp này được dùng để định lượng S. aureus trong mẫu có mật độ S. aureus thấp nhưng mật độ vi sinh vật cạnh tranh cao, khó có thể xác định bằng phương pháp đếm khuẩn lạc. Dung dịch mẫu được pha loãng thập phân với 3 độ pha loãng liên tiếp. Tùy theo yêu cầu về độ chính xác của kết quả phân tích, có thể sử dụng phương pháp MPN với hệ thống 9 ống nghiệm (3 độ pha loãng với 3 lần lặp lại ở mỗi độ pha loãng) hay hệ thống 15 ống nghiệm (3 độ pha loãng với 5 lần lặp lại ở mỗi độ pha loãng). Hình thái khuẩn lạc điển hình trên môi trường Baird- Parker khi ủ 35oC trong 48 giờ. Mẫu được kết luận là có S. aureus khi thử nghiệm coagulase dương tính [13]. Ưu điểm của phương pháp đếm khuẩn lạc: 7 Cho phép xác định số lượng tế bào vi sinh vật còn sống hiện diện trong mẫu Cho phép định lượng chọn lọc vi sinh vật tùy môi trường và điều kiện môi trường [13]. Độ nhạy cao, cho phép định lượng vi sinh vật ở mức độ thấp trong mẫu [16]. Nhược điểm: Tốn nhiều thời gian và nhân lực. 2.3.1.3. Phương pháp MPN (Most Probale Number) Nguyên tắc: Tiêu chuẩn để xác định S. aureus là dựa vào các đặc điểm sau: Staphylococcus aureus mọc được trên môi trường canh thang TSB có bổ sung thêm 10% NaCl và 1% sodium pyruvate [13]. Hình thái khuẩn lạc điển hình trên môi trường thạch Baird- Parker sau khi ủ 35oC trong 48 giờ. Mẫu được kết luận là có S. aureus khi thử nghiệm coagulase dương tính [16]. 2.3.2. Phương pháp hiện đại 2.3.2.1. Phương pháp RPLA (Reversed Passive Latex Aggulutination) Kỹ thuật RPLA được ứng dụng để phát hiện độc tố trong thực phẩm cũng như phát hiện những dòng Staphylococcus có độc tố dương tính. Trong kỹ thuật này, hạt nhựa được phủ kháng thể của độc tố trước khi cho vào giếng. Cho mẫu vào để tạo phản ứng nếu có độc tố trong mẫu thì phản ứng giữa độc tố và kháng thể sẽ tạo ra sự ngưng kết, tùy mức độ ngưng kết mà xác định được lượng độc tố. Phương pháp này đủ nhạy để phát hiện độc tố trong hầu hết thực phẩm của các vụ ngộ độc, cũng như trong việc phát hiện những dòng Staphylococcus tạo ra lượng độc tố thấp mà phương pháp gel- diffusion không được phát hiện, chỉ với khoảng 10- 20ng/ml. Bộ kit RPLA được giới thiệu bởi công ty Denka Seiken, Niigata, Nhật Bản và được bán tại Mỹ [27]. 2.3.2.2. Kỹ thuật lai phân tử Phương pháp này còn gọi là phương pháp mẫu dò, probes. Dùng để phát hiện vi sinh vật trong thực phẩm dựa trên sự phát hiện một đoạn gen đặc trưng của vi sinh vật. Cơ sở của việc sử dụng mẫu dò là quá trình lai phân tử. Quá trình này bao gồm sự tách rời hai mạch đơn của chuỗi xoắn kép DNA và sự tái bắt cặp giữa các đoạn DNA có nhiệt độ nóng chảy Tm của phân tử DNA và sự tái bắt cặp giữa các đoạn DNA có trình tự nucleotide bổ sung khi nhiệt độ trở lại bình thường. Một trong hai mạch DNA bổ sung được cố định trên một giá thể rắn. Sự lai phân tử xảy ra khi đoạn mồi có trình tự nucleotide bổ sung với trình tự DNA mục tiêu gặp nhau do chuyển động nhiệt [7]. Thử nghiệm DNA hybridization sử dụng đầu dò DNA S. aureus và thiết bị đo màu để phát hiện S. aureus trong thực phẩm sau khi đã làm giàu mẫu. Phương pháp này dùng để định lượng xác định sự hiện diện của S. aureus ở mức độ nhiễm > 3 tế bào/g mẫu thực phẩm gốc. Một mẫu được xem là không có sự hiện diện của S. aureus nếu giá trị hấp thụ 8 thu được ít hơn hoặc bằng giá trị giới hạn mà thử nghiệm đã thiết lập. Ngược lại, một mẫu được xem là có sự hiện diện của S. aureus, nếu giá trị hấp thụ thu được lớn hơn giá trị giới hạn mà thử nghiệm đã thiết lập [7]. Ưu điểm: Kỹ thuật này có thể sử dụng đầu dò với đoạn rARN đích do vậy có tính chính xác và độ nhạy cao. Cho phép sự phát hiện sự có mặt của nhiều loại vi sinh vật một lúc với thời gian nhanh. Nhược điểm: Kỹ thuật này khá phức tạp. Phải tốn công thiết kế các mẫu dò và sử dụng vật liệu phóng xạ. 2.3.2.3. Phương pháp ELISA Phương pháp ELISA được ứng dụng để phát hiện độc tố S.aureus trong thực phẩm khá phổ biến. Đây là phương pháp đơn giản, nhanh, nhạy có thể phát hiện cũng như định lượng độc tố và có nhiều bộ kit phát hiện độc tố đang được bán trên thị trường [10]. Kiểu ELISA thường gặp nhất là phương pháp sandwich. Trong phương pháp này, kháng thể được gắn với mẫu chưa biết, sau đó phức hợp kháng thể - độc tố được gắn với cộng hợp enzyme – kháng thể. Qui trình này được sử dụng nhiều vì lượng enzyme và màu được tạo ra từ phản ứng enzyme – cơ chất tỉ lệ thuận với lượng độc tố có trong mẫu chưa biết. Hai enzyme alkaline photphatase và horseradish peroxidase đều được dùng trong phương pháp này, nhưng alkaline photphatase dễ gắn với kháng thể hơn. Tuy nhiên horseradish peroxidase cho phản ứng nhạy hơn, khi kết hợp với cơ chất cho màu xanh lá, xanh dương hay cam, còn màu được tạo ra với cơ chất khi sử dụng với alkaline photphatase, nitrophenyl photphatase (pNPP) là màu vàng. Hầu hết các phương pháp ELISA nhạy ở ít nhất là 0,5ng độc tố/ml [10]. Ưu điểm của phương pháp ELISA: - Nhanh chóng và thuận tiện. - Kháng nguyên có nồng độ rất thấp hoặc không biết có thể được phát hiện kể từ khi bắt giữa kháng thể chỉ lấy kháng nguyên cụ thể. - Có thể phát hiện sự khác biệt nhỏ giữa các kháng nguyên nếu sử dụng kháng thể bắt và kháng thể phát hiện khác nhau [10]. Nhược điểm của phương pháp ELISA Bên cạnh những ưu điểm trên thì phương pháp ELISA còn một số hạn chế như: - Thời gian xét nghiệm lâu. 9 - Chỉ có các kháng thể đơn dòng có thể được sử dụng như cặp phù hợp. - Kháng thể đơn dòng có chi phí nhiều hơn so với các kháng thể đa dòng [10]. 2.4. Tổng quan về kỹ thuật PCR (Polymerase Chain Reaction) 2.4.1. Khái niệm PCR PCR là phản ứng chuỗi trùng hợp hay còn gọi là “phản ứng khuếch đại gen” trong điều kiện phòng thí nghiệm. 2.4.2. Nguyên tắc của thử nghiệm PCR PCR là một thử nghiệm nhằm khuếch đại chuỗi nucleic acid đích thành hàng tỷ bản sao để sau đó có thể phát hiện được. Ðể thực hiện được việc khuyếch đại acid nucleic đích, thử nghiệm PCR dựa vào những chu kỳ nhiệt mà mỗi chu kỳ có 3 bước (hình 2.2) [14], [15], [17]. Ðầu tiên là nhiệt độ được nâng lên khoảng 95oC để làm biến tính acid nucleic đích từ dạng sợi đôi (dsDNA) thành sợi đơn (ssDNA), đây là giai đoạn biến tính (denaturation). Kế đó là giai đoạn gắn mồi, lúc này nhiệt độ trong buồng ủ PCR hạ xuống khoảng 55 C để các đoạn mồi bắt cặp theo nguyên tắc bổ sung vào hai đầu của chuỗi nucleic acid đích. Cặp mồi được thiết kế ở hai đầu của trình tự đích và do đó sự tổng hợp DNA chỉ xảy ra với đoạn DNA đích nằm giữa hai mồi. Nhiệt độ gắn mồi phụ thuộc vào độ dài và trình tự của mồi, thông thường nằm trong khoảng 45- 60oC. o Cuối cùng là giai đoạn kéo dài (extension), lúc này nhiệt độ được nâng lên khoảng 72 C là nhiệt độ thích hợp để enzyme polymerase chịu nhiệt xúc tác phản ứng tổng hợp bản sao của DNA đích theo nguyên tắc bổ sung trên khuôn là các sợi đơn (ssDNA) đích đã được đoạn mồi bắt bặp vào trước đó (ở giai đoạn bắt cặp). Sự tổng hợp này cần phải có sự hiện diện các deoxynucleoside triphosphate (dNTP), và chiều của sự tổng hợp là 5’- 3’ (đoạn mồi) hay 3’- 5’ (ssDNA đích). o Sau 30 đến 40 chu kỳ nhiệt, để hoàn tất thử nghiệm PCR, thường có thêm giai đoạn kéo dài cuối cùng. Giai đoạn này nhiệt độ được giữ 72oC trong thời gian tương đối lâu, từ 5 phút đến 30 phút. 10 Hình 2.2. Các bước thực hiện một chu kỳ phản ứng PCR Như vậy từ một số lượng N DNA đích ban đầu, sau n chu kỳ nhiệt, thử nghiệm PCR đã tổng hợp được N.2n bản sao. Với một số lượng bản sao, hay còn gọi là sản phẩm PCR (PCR product), chúng dễ dàng được phát hiện bằng các phương pháp phát hiện nucleic acid (điện di phát hiện kích thước của sản phẩm bằng probe tóm bắt, Southern blot rồi phát hiện sản phẩm) [18]. 2.4.3. Thành phần phản ứng Ðể thử nghiệm PCR có thể chạy được, cần phải có đầy đủ các thành phần sau [18]. - DNA khuôn: chuỗi acid nucleic (ví dụ đoạn acid nucleic đặc hiệu của vi khuẩn gây bệnh, của gene bệnh lý, của dấu ấn di truyền…) mà phản ứng PCR sẽ khuếch đại lên để chúng có thể được phát hiện trong bệnh phẩm. Phản ứng PCR sẽ không xảy ra được nếu bệnh phẩm không có acid nucleic đích [14]. - Primer hay đoạn mồi, tức là những đoạn DNA đơn (oligonucleotide) có kích thước chỉ vài chục base (18-30), có thể bắt cặp theo nguyên tắc bổ sung vào đoạn khởi đầu và đoạn kết thúc của chuỗi DNA đích khi chuỗi đích này được biến tính thành sợi đơn. Trong thử nghiệm PCR, đoạn mồi có hai vai trò chính : + Quyết định nên tính đặc hiệu của thử nghiệm, vì nếu đoạn mồi được chọn càng đặc hiệu cho chuỗi đích, nghĩa là chỉ có thể bắt cặp trên chuỗi đích mà không thể bắt cặp được trên các chuỗi DNA khác ngoài chuỗi đích, thì sản phẩm PCR càng đặc hiệu và thử nghiệm PCR càng đặc hiệu. + Khởi động men polymerase vì men polymerase chỉ có thể bắt đầu tổng hợp sợi bổ sung cho chuỗi DNA đích một khi nó nhận dạng được đầu 3’ (là đầu mà nó xúc tác 11 cho một dNTP được gắn vào) đang ở tình trạng sợi đôi. Thông thường trong phản ứng PCR, người ta dùng một cặp mồi (mồi xuôi- mồi ngược). Cặp mồi này quyết định nên kích thước của sản phẩm PCR. Chúng càng bắt cặp trên chuỗi đích xa nhau bao nhiêu thì kích thước của sản phẩm PCR càng lớn bấy nhiêu và ngược lại, càng gần nhau bao nhiêu thì kích thước càng nhỏ bấy nhiêu [14]. - dNTPs: deoxynucleoside triphosphate, là đơn vị để có thể tổng hợp được các bản sao của DNA đích, dNTP có cấu tạo gồm một đường deoxyribose có gắn một base, có thể là adenine (dATP) hay thymine (dTTP) hay Cytosine (dCTP) hay guanine (dGTP), ở carbone số 1 (C1). Ba phân tử phosphate (triphosphate) được gắn tại carbone số 5 (C5) của phân tử deoxyribose này và đây chính là nơi mà dNTP gắn vào đầu 3’ của chuỗi bổ sung trên chuỗi đích [14], [18]. - Enzyme polymerase là loại enzyme chịu được nhiệt độ. Ngày nay có nhiều loại men polymerase chịu được nhiệt độ đã được ly trích hoặc tổng hợp, tùy mục đích sử dụng mà chúng ta có thể chọn polymerase thích hợp. Thường dùng nhất trong các phòng thí nghiệm là Taq DNA polymerase. Là men polymerase trích từ vi khuẩn Thermus aquaticus, là các vi khuẩn sống được trong các suối nước nóng [18]. - Dung dịch đệm cho phản ứng PCR, thường chứa muối đệm Tris HCl 10 mM, KCL 50mM và MgCl2 1,5mM. Ngoài ra dung dịch đệm PCR còn có thể chứa 0,001% BSA hay Gelatine và trong một số phản ứng PCR còn có thể thêm tween hay formamide nữa. Trong các thành phần trên, có lẽ ảnh hưởng lên thử nghiệm PCR nhiều nhất là nồng độ MgCl2, vì vậy để có được một thử nghiệm PCR có độ nhạy cao, phản ứng rõ nét, người ta phải tối ưu hóa phản ứng bằng cách thăm dò một nồng độ MgCl2 thích hợp nhất. Ngoài ra, một thiết bị hết sức quan trọng cho thử nghiệm PCR là máy chu trình nhiệt (thermal cycler) là máy có thể đưa nhiệt độ trong buồng ủ PCR lên cao rồi hạ xuống trong những khoảng thời gian nhất định theo chương trình mà người sử dụng định sẵn [14]. 2.4.4. Những ưu điểm hạn chế của kỹ thuật PCR - Ưu điểm: Thời gian thực hiện nhanh, chỉ cần 3 giờ là có thể khuếch đại được một trình tự đáng quan tâm. Thực hiện đơn giản và ít tốn kém ( được thực hiện trong ống nghiệm plastic nhỏ gồm thành phần tối thiểu được thực hiện đồng thời). Yêu cầu về độ tinh sạch của mẫu không cao (vết máu khô, mẫu vật khảo cổ, những vết tích để lại của người đã chết) [14]. Các phương pháp dựa trên PCR nhạy và chuyên biệt, cho phép phát hiện Staphylococcus aureus tạo độc tố trong thời gian tương đối ngắn với lượng mẫu nhỏ. Ưu điểm của phương pháp này là những tế bào sinh độc tố đã chết vẫn có thể phát hiện, điều này rất quan trọng trong việc phân tích những thực phẩm đã xử lí nhiệt liên quan những vụ ngộ độc thực phẩm [14] [18]. 12 - Hạn chế: Tuy phương pháp PCR có ưu điểm là nhanh, nhạy, chuyên biệt nhưng chỉ có thể xác định có sự hiện diện của các gen mã hóa độc tố mà không thể xác định được có tạo độc tố hay không cũng như việc định lượng độc tố. Phản ứng PCR cần phải có DNA mồi đặc trưng cho DNA cần khuếch đại. Để có đoạn mồi này ít nhất phải biết trước trình tự nucleotide cần khuếch đại. Kích thước DNA cần khuếch đại không vượt quá 3kb. Khả năng ngoại nhiễm lớn (do thao tác nhiều lần). Sai sót còn do sử dụng enzyme taq polymerase khoảng 104 (sai sót cho một lần sao chép) [18]. 2.4.5. Ứng dụng của kỹ thuật PCR trong phát hiện nhanh vi sinh vật gây bệnh Bằng các khuếch đại đoạn acid nucleic đặc trưng của vi sinh vật gây bệnh trong mẫu bệnh phẩm, PCR có thể phát hiện vi sinh vật gây bệnh với độ nhạy cao. Vì PCR chỉ cần một vi sinh vật gây bệnh có mặt trong mẫu thử là có hiện diện acid nucleic đích và được PCR khuếch đại [14]. Một ưu điểm khác của PCR trong chẩn đoán bệnh nhiễm khuẩn là PCR không những phát hiện được tác nhân vi sinh vật gây bệnh trực tiếp trong bệnh phẩm mà còn có thể phân loại type di truyền của các vi sinh vật này, không cần phải nuôi cấy vi khuẩn. Ðây là một đóng góp rất lớn trong nghiên cứu dịch tễ học tìm hiểu mối liên quan của các tác nhân gây bệnh trong cộng đồng. Ngoài ra PCR còn có thể phát hiện vi khuẩn kháng kháng sinh ví dụ phát hiện M. tuberculosis kháng rifampicin, một chìa khóa để bác sĩ điều trị có thể sử dụng phát đồ điều trị đúng cho bệnh nhân [2], [14]. Trong vi sinh học, PCR là một phương tiện hữu ích để phát hiện các tác nhân vi sinh vật gây bệnh trong các trường hợp tác nhân không thể nuôi cấy thường quy: như các virus (viêm gan B, viêm gan C, Herpes…), các vi khuẩn (Chlamydia, Legionella, Mycoplasma, Treponema pallidum…), tác nhân nuôi cấy thất bại vì có mặt rất ít trong bệnh phẩm, đã bị điều trị kháng sinh trước đó (vd: Lao thất bại nuôi cấy, viêm màng não mủ mất đầu…) [7], [14]. Trong nước đã có nhiều công trình nghiên cứu về ứng dụng PCR để phát hiện vi sinh vật gây bệnh trong thực phẩm như Lê Văn Phủng (2001) [14], Nguyễn Thị Kê, Cao Minh Nga (2006) [10]. Đã áp dụng kỹ thuật PCR để phát hiện S. aureus trong thực phẩm nhằm rút ngắn thời gian giúp người làm công tác xét nghiệm và các nhà dịch tễ sớm có định hướng trong chẩn đoán các vụ dịch ngộ độc thực phẩm. Giá thành tương đối phù hợp đã mở ra một triển vọng mới cho các phòng xét nghiệm vi sinh thực phẩm. Trên thế giới hiện nay có rất nhiều phương pháp để phát hiện vi sinh vật gây bệnh trong thực phẩm nhưng PCR có nhiều ưu điểm hơn các phương pháp khác nên được ứng dụng rộng rãi. Các nghiên cứu của Fang T.J. và cs (1999) [23], H.- L. Wei, C.- S. Chiou (2001) [24] và Jogensen H.J. và cs (2004) [25] cũng đã ứng dụng kỹ thuật PCR để phát hiện Staphylococcus aureus nhiễm trong thực phẩm chủ yếu trong thịt, trứng và sữa. 13 Phần 3 ĐỐI TƯỢNG, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. Đối tượng và phạm vi nghiên cứu 3.1.1. Đối tượng nghiên cứu - Vi khuẩn Staphylococcus aureus: do Viện CNSH & CNTP - Trường Đại học Bách Khoa Hà Nội, Bộ môn Vi sinh thuộc Khoa Y học cơ sở - Trường ĐH Y- Dược Thái Nguyên, Viện Khoa học sự sống - Trường Đại học Nông Lâm Thái Nguyên, Trung tâm y tế dự phòng Thái Nguyên cung cấp. - Các chủng vi sinh vật kiểm định: do Viện Khoa học sự sống - Trường Đại học Nông Lâm Thái Nguyên, Trung tâm y tế dự phòng Thái Nguyên cung cấp. 3.3. Vật liệu, thiết bị, hóa chất nghiên cứu 3.3.1. Vật liệu ngiên cứu Cặp mồi được đặt sản xuất tại hãng Intergrated DNA Technologies của Mỹ (www.IDTDNA.com). Trình tự mồi được liệt kê trong bảng sau: Bảng 3.1. Trình tự cặp mồi thiết kế được Tên Trình tự nucleotide (5’→3’) mồi Tm o ( C) NucF TTCAAGTCTAAGTAGCTCAGCA 54 NucR GCCACGTCCATATTTATCAGTTC 54 Kích thước sản phẩm PCR (bp) 439 3.4. Nội dung nghiên cứu 3.4.1. Thiết kế cặp mồi cho phản ứng PCR 3.4.3. Xây dựng qui trình phát hiện nhanh Staphylococcus aureus bằng kỹ thuật PCR 3.4.5. Xác định giới hạn phát hiện của phản ứng PCR trong phát hiện nhanh Staphylococcus aureus 3.5. Phương pháp nghiên cứu 3.5.1. Phương pháp thiết kế cặp mồi cho phản ứng PCR từ vi khuẩn Staphylococcus aureus - Sưu tập các trình tự gen nuc của Staphylococcus aureus khác nhau trên ngân hàng gen NCBI. - So sánh 50 trình tự gen nuc sưu tập được sử dụng phần mềm CLUSTALW2 để tìm các vùng trình tự gen giống nhau giữa 50 trình tự. 14
- Xem thêm -