Tài liệu Cây sinh dòng virus prrs

  • Số trang: 21 |
  • Loại file: PDF |
  • Lượt xem: 54 |
  • Lượt tải: 0
trangtranthi64149

Tham gia: 04/06/2016

Mô tả:

BỘ GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC oo BÀI BÁO CÁO Chủ đề 27: CÂY SINH DÒNG VIRUS PRRS Giáo viên hướng dẫn : TS.NGUYỄN NGỌC HẢI Sinh viên thực hiện: LUYỆN THỊ NGÂN Lớp: DH06SH MSSV: 06126089 Thành phố Hồ Chí Minh 1 I.Đặt vấn đề: -PRRSV (Porcine reproductive and respiratory syndrome virus) gây hội chứng rối loạn sinh sản ở heo hay còn gọi là bệnh heo tai xanh, gây thiệt hại nghiêm trọng cho nền kinh tế ở các nước trên thế giới. Hiện nay đã có vaccine, tuy nhiên các vaccine này không có khả năng bảo hộ cho heo. Người ta phát hiện thấy virus PRRS có sự đột biến cao, tạo ra nhiều chủng có độc lực khác nhau, rất khó để kiểm soát dịch bệnh. Do đó, để hiểu rõ về các chủng virus PRRSV, người ta xây dựng cây sinh dòng cho virus này,nó cần thiết cho việc xác định nguồn gốc, lan truyền và tiến hóa của virus PRRS. II. Tổng quan II.1.Giới thiệu về virus PRRS II.1.1. Lịch sử phát hiện virus PRRS Hội chứng rối loạn sinh sản hô hấp ở heo do virus thuộc nhóm Arterividae có khả năng xâm nhiễm vào đại thực bào vào mô. Các đại thực bào với các "chân giả" có tác dụng bắt giữ các tác nhân gây bệnh và như vi khuẩn, virus tiêu diệt chúng (Nguồn Boehringer Ingelheim Vetmedica GmbH) -Năm 1987 bệnh được ghi nhận lần đầu tiên ở Mỹ , vào thời điểm đó, do chưa xác định được căn nguyên bệnh nên được gọi là “bệnh bí hiểm ở lợn” (MDS). Khi bị virus phá hủy, đại thực bào không còn các "chân giả", mất khả năng bắt giữ và tiêu diệt tác nhân gây bệnh (Nguồn Boehringer Ingelheim Vetmedica GmbH) 2 -Tháng 1 năm 1991 ở Tây Ban Nha phát hiện trường hợp lâm sàng đầu tiên trên đàn heo nhập khẩu. Ở Hà Lan bệnh cũng được báo cáo. -Tháng 3 năm 1991 ở Bỉ cũng xuất hiện bệnh. -Tháng 5 năm 1991ở An ghi nhận những trường hợp đầu tiên. -Tháng 10 năm 1991 ở Pháp, những trận dịch đầu tiên xảy ra ở Britany. -Tháng 3 năm 1992 ở Đan Mạch dịch bệnh xuất hiện. - Năm 1992, Hội nghị quốc tế về bệnh này được tổ chức tại St. Paul, Minnesota đã nhất trí dùng tên PRRS và đã được Tổ chức Thú y Thế giới công nhận. -Collin và cộng tác viên (1992) là người đầu tiên xác định căn nguyên của PRRS, ông đã gây được bệnh thực nghiệm bằng cách gây nhiễm trên heo qua đường hô hấp từ các mẫu mô heo bệnh tại địa phương. -Khoảng một năm sau đó, Viện Nghiên cứu Thú Y Trung ương tại Lelystad (Hà Lan) đã phân lập được virus từ đại thực bào phế nang của heo bệnh và gọi đó là virus Lelystad (LV). -Không lâu sau đó, những nhà nghiên cứu của Mỹ cũng phân lập được virus liên quan đến bệnh này đặt tên VR-2332. Họ cũng phân biệt được sự khác nhau giữa LV và VR-2332 về mặt kiểu gen và kiểu hình. Bên cạnh sự khác biệt quan trọng giữa LV và VR-2332 thì những chủng virus Bắc Mỹ trên cùng đàn heo và cùng thời điểm cũng có sự khác nhau. -Năm 1994 PRRSV được chính thức phát hiện ở 16 quốc gia thuộc Châu Âu, Châu Mỹ, Châu Á. -Năm 1997 Ở Việt Nam, bệnh được phát hiện trên đàn lợn nhập từ Mỹ -Tháng 9 năm 2006 Trung Quốc đã xảy ra đại dịch PRRSV, trên 2 triệu heo mắc bệnh, hơn 400000 heo chết. Người ta xác định có sự biến chủng của PRRSV thành chủng độc lực cao, lây lan và gây chết rất nhanh trên heo. II.1.2. Kích thước và hình thái học virus PRRS. -Những nhà nghiên cứu đã chứng minh rằng, virus PRRS có quan hệ gần về mặt sinh vật học, về cấu trúc, về gen với virus gây viêm động mạch ngựa (equine arteritis virus-EVN ) , virus gây tăng enzyme khử hydro của lactate ( lactate dehydrogenase elevating virus-LDV) ở chuột và virus gây sốt xuất huyết ở khỉ (simian hemorrhagic fever virus-SHFV). Theo nguyên tắc dựa trên những đặc tính chung này , virus PRRS, EVA và SHFV được xếp chung cùng một nhóm mới thuộc chi Arterivirus , họ Arrterividae , bộ Nidovirales. -Virus PRRS có vỏ bọc với đường kính 50-60 nm, bề mặt khá nhẵn và có lõi nucleocapsid hình khối với đường kính 25-35 nm. 3 GP : protein của màng (glycoprotein) M : protein gian màng (a membrane-spaining protein) N : protein của capsid (nucleocapsid protein) E : protein của vỏ ngoài Hình 1: Hình bộ gen của PRRSV II.1.3. Tổ chức gen virus PRRS -Bộ gen của vius PRRS tương tự với những Arterivirus khác. Virion chứa acid nhân RNA 15.1kb, dạng thẳng, một sợi, poly adeny (PolA) ở đầu dương. -Bộ gen chứa tám vùng đọc mở mã hóa cho những protein đặc hiệu của virus. ORF1a và ORF1b chiếm 12kb. Ở đầu 5’ của gen mã hóa cho protein liên quan đến việc mã hóa RNA và dịch mã, bao gồm RNA polymerase phụ thuộc RNA, còn lại 3,5kb nằm ở đầu 3’ của bộ gen chứa ORF2, ORF3, ORF4, ORF5, ORF6 và ORF7 được mã hóa cho những protein cấu trúc của virus. 4 Hình 2: Mô hình các protein cấu trúc của PRRSV. II.2 Nguyên lý chung của phương pháp PCR PCR là phương pháp nhân nhanh một đoạn phân tử DNA trong ống nghiệm. Đây là một kỹ thuật nhằm tạo ra hàng triệu đoạn DNA đồng nhất từ một hỗn hợp các phân tử bao gồm RNA, protein, polysacharide, DNA không có chức năng và DNA có chức năng di truyền. Người ta còn gọi đó là kỹ thuật tạo dòng DNA invitro. Ngày nay PCR được dùng rất phổ biến trong nhiều lĩnh vực về sinh học. PCR được thực hiện trên cơ sở sinh tổng hợp DNA theo nhiều chu kỳ nối tiếp nhau, mỗi chu kỳ gồm 3 trình tự như sau : Bước 1: Biến tính (Denature) Giai đoạn này được thực hiện ở nhiệt độ cao (94 - 95o C) trong vòng 30 giây đến 1 phút, làm cho phân tử DNA mạch kép tách hoàn toàn thành 2 mạch đơn. Chính 2 mạch đơn này đóng vai trò là mạch khuôn cho sự tổng hợp 2 mạch bổ sung mới. 5 Bước 2: Bắt cặp (Annealing) Phản ứng của primer tác động lên dây nền, các primer này gắn vào đầu dây chuỗi mã đối xứng với chuỗi mã trên dây template để có phân tử DNA mới. Ở giai đoạn này nhiệt độ được hạ thấp đến mức cho phép các primer bắt cặp được với khuôn, nhiệt độ này dao động trong khoảng 30 – 70oC, kéo dài trong khoảng 30 giây đến 1 phút, tùy thuộc vào nhiệt độ nóng chảy Tm (melting temperature) của các primer sử dụng. Bước 3: Kéo dài (Extension) Đây là giai đoạn tổng hợp dây đơn bổ sung dọc theo chiều 5’ - 3’ của 2 primer nhờ hoạt động của polymerase. Nhiệt độ được tăng lên 72oC giúp cho DNA polymerase hoạt động tốt nhất. Thời gian của giai đoạn này tùy thuộc vào độ dài của trình tự DNA khuếch đại, thường kéo dài từ 30 giây đến vài phút. Hình 3: Nguyên tắc cơ bản của phản ứng PCR 6 Nguyên tắc cơ bản của phản ứng PCR là khuếch đại một đoạn gen quan tâm bằng primer chuyên biệt kết hợp với hoạt động của enzym chịu nhiệt polymerase như Taq DNA polymerase trong một chu trình nhiệt hợp lý. Tác động của primer được xem như yếu tố đánh dấu cho hoạt động của polymerase khi nó được gắn kết vào DNA mạch đơn làm khuôn trong giai đoạn bắt cặp. Primer bên trái tác động trên dây DNA 3’ - 5’ còn được gọi là forward primer, kí hiệu là F. Primer bên phải tác động trên dây 5’ - 3’ còn được gọi là reverse primer, kí hiệu là R. Sự sắp xếp như vậy đảm bảo vùng bị can thiệp được tăng cường hoạt động, theo 3 trình tự đã nói ở trên. Tóm lại, khi các primer kết hợp với sợi DNA đối lập của nó trong điều kiện một khoảng cách đã được kích hoạt, các đoạn DNA này có thể sẽ được khuếch đại lên theo phản ứng dây chuyền với polymerase. II.3. Nguyên lý chung của phương pháp RT-PCR Về nguyên lý, kỹ thuật RT-PCR cũng giống như kỹ thuật PCR thông thường nhưng nhằm mục đích khuếch đại đoạn gen từ khuôn RNA thay vì DNA. Trong kỹ thuật này có hai giai đoạn khuếch đại được thực hiện: giai đoạn đầu là quá trình tổng hợp đoạn cDNA từ khuôn mẫu sợi RNA và giai đoạn sau là quá trình tổng hợp DNA từ khuôn mẫu sợi cDNA vừa được tổng hợp. Khác với kỹ thuật PCR chỉ sử dụng một enzym tổng hợp chuỗi oligonucleotide, trong kỹ thuật RT-PCR có sự tham gia của hai loại enzym tổng hợp chuỗi oligonucleotide: enzym phiên mã ngược và enzym tổng hợp chuỗi oligonucleotide. Do enzym reverse transcriptase chịu nhiệt kém nên quá trình phiên mã ngược đẻ tổng hợp cDNA thường phải thực hiện ở nhiệt độ thấp (thường khoảng từ 42-45 oC). II.4.Nguyên lý chung của phương pháp nested PCR 7 Kỹ thuật nPCR được phát triển nhằm mục đích gia tăng độ nhạy và độ đặc hiệu của phản ứng PCR. Trong kỹ thuật này, có hai cặp primer khác nhau được sử dụng nhưng chỉ để nhằm khuếch đại đặc hiệu một đoạn gen và phản ứng PCR phải thực hiện hai lần. Lần đầu, phản ứng PCR được thực hiện trong 15-30 chu kỳ, với cặp mồi thứ nhất. Cặp mồi thứ nhất, ở lần chạy PCR thứ 1, cho phép khuếch đại đoạn gen dài hơn đoạn gen cần xác định và đoạn gen cần xác định nằm trong đoạn gen được khuếch đại lần 1. Sản phẩm của PCR lấn 1, sau đó sẽ là mẫu cho PCR lần 2. Cặp mồi thứ hai sẽ bắt cặp phía trong (nested) của sản phẩm PCR lần 1. Phản ứng PCR lần 2 sau đó sẽ khuếch đại đoạn gen cần xác định. 8 Hình 4: Nguyên tắc cơ bản của phản ứng nested PCR II.5. Nguyên lý cơ bản của phương pháp RT-nPCR một ống Sử dụng một film bằng plastic, nó cho phép phiên mã ngược và nested PCR trong một ống duy nhất. hỗn hợp phản ứng cho phăn ứng khuếch đại PCR lần hai được cách ly trong cái nắp của ống phăn ứng trong suốt chu kỳ khuếch đại đầu tiên bằng bộ phận một film bằng plastic và sau đó được đưa vào trong phản ứng PCR từ chu kỳ phản ứng đầu tiên băng ly tâm không mở nắp phản ứng. Thuận lợi chủ yếu của phương pháp là độ nhạy cao, độ chuyên biệt cao, đơn giản, hiệu quả, nguy cơ tạp nhiễm thấp và dễ dàng trong việc thiết lập điều kiện nested PCR. Phương pháp này thích hợp cho việc phát hiện các mục tiêu. III. Phương pháp tiến hành: III.1.Ly trích RNA -RNA được ly trích từ 250 µl huyết thanh hoặc từ 20-50 mg mô, sử dụng kit ‘ Total RNA Prep Plus’. Sau khi ly trích, RNA được tách rửa với 100 µl nước không Rnase -Toàn bộ RNA được sử dụng làm khuôn trong phản ứng RT-nPCR một ống đặc biệt cho ORF5 của EU-PRRSV III.2.Thực hiện phản ứng RT-nPCR của ORF5 Bước 1: 5 µl trehalose 22 % được sử dụng để bảo quản và duy trì hỗn hợp bên dưới trong dung dịch của các ống Eppendorf 0.2 ml: 20pmol cho mỗi mồi trong (inners) ORF5F(5'ATGAGATGTTCTCACAAATTGGGGCG3') và ORF5R(5'CTAGGCCTCCCATTGCTCAGCCGAAGT3') (Suarez et al., 1996 ) 1 µl dNTPs (10 mM) .25 µl Taq Polymerase (1·25 U, Fermentas, Vilnius, Lithuania). -Để bảo quản thì các ống được sấy khô khoảng 2h nhiệt độ phòng. Bước 2 -Tiến hành phản ứng RT-PCR trong đáy ống chứa chất được làm khô, sử dụng chất phản ứng được xử lý trehalose trong nắp ống Eppendorf. Sự khuếch đại được thực hiện trong 50 µl thể tích có chứa: 5 µl RNA và những chất phản ứng sau: 9 5 µl 10x PCR buffer [100 mM Tris–HCl (pH 8·8) 500 mM KCl], 0·8% Nonidet P40 (Fermentas) 5 µl MgCl2 (25 mM, Fermentas) 2 µl dNTPs (10 mM, Sigma) 5 pmol cho mỗi mồi outer EUORF5B (5' CAATGAGGTGGGCIACAACC 3') và EUORF5C (5' TATGTIATGCTAAAGGCTAGCAC 3') (Oleksiewicz et al., 1998 ) 1 µl 10% Triton X-100 (Sigma) 0·5 µl (2·5 U) Taq DNA polymerase (Fermentas) 0·25 µl (10 U) RNasin (Promega) 0·5 µl (100 U) MMLV phiên mã ngược -Dầu khoáng được tính đến để hoạt động như một vật cản hơi nước giữa phản ứng RT-PCR và chất phản ứng được làm khô ở trong nắp ống Eppendorf. Sau đó,những ống này bắt buộc phải trải qua chu trình nhiệt sau: 42 °C trong 30 phút 95 °C trong 5 phút -Sau đó là 20 chu kỳ ở: 94 °C trong 1 phút 55 °C trong 1 phút 72 °C trong 1.5 phút. -Tiếp sau đó,những ống nghiệm được đảo ngược một vài lần để hòa tan những chất phản phản ứng khô trong nắp để bắt đầu phản ứng nestedPCR. Những ống nghiệm sau đó được ly tâm trước khi trở lại chu trình nhiệt của phản ứng nestedPCR. Bước 3: Phản ứng nestedPCR tiến hành trong 35 chu kỳ với chu trình nhiệt sau: 94 °C trong 1 phút 55 °C trong 1 phút 72 °C trong 1.5 phút. -Một bước kéo dài ở 72 oC for 10 min hoàn thành quá trình khuếch đại.Sản phẩm cuối của sự khuếch đại là 606 bp. III.3.Thực hiện phản ứng RT-nPCR của ORF7. -Từ RNA chọn lọc, ORF7 cũng được khuếch đại. 5 µl RNA trộn với 8.25 µl nước, 4 µl của 5X MMLV RT buffer, 1 µl dNTPs( 10mM mỗi loại), 0.5 µl MMLV, 0.25 µl Rnasin và 1 µl hexanucleotide ngẫu nhiên(100ng). 10 -Dầu khoáng được thêm vào để hoạt động như một vật cản hơi nước. -Để tiến hành phiên mã ngược, hỗn hợp được ủ ở 370 C trong 10 phút. -5 µl cDNA tổng số được khuếch đại bằng phản ứng RT-PCR trong thể tích 50 µl : 28.8 µl nước, 10 µl 5x dung dịch đệm phản ứng Taq polymerase, 5 µl 25 mM MgCl2, 4 µl dNTPs, 1 U Taq Polymerase (Fermentas) và 20 pmol của mỗi primer: 5' GCCCCTGCCCAICACG 3' và 5' TCGCCCTAATTGAATAGGTGA 3' (Oleksiewicz et al., 1998). -Chu trình nhiệt được thực hiện trong 35 chu kì với chu trình nhiệt sau: 94 oC trong 15 giây 52oC trong 30 giây 72 oC trong 30 giây -Một bước kéo dài ở 72 oC trong 10 phút hoàn thành quá trình khuếch đại. Kích thước mong chờ của ORF7 khuếch đại là 637 bp. III.4.Phân tích trình tự nucleotide Để giải trình tự,những sản phẩm PCR được chạy điện di trên gel agar 1.5%. Sau đó nhuộm ethidium bromide và khử muối trong nước siêu lọc(ultafiltered water). - Kích thước băng mong muốn được cắt bỏ từ gel, sử dụng dụng cụ máy lọc quay tròn 0.45 µm Ultrafree-MC để phục hồi DNA, những sản phẩm PCR tinh sạch đươc giải trình tự bằng kit BigDye Terminator Cycle Sequencing và một máy giải trình tự ABI310. -Trình tự từ hai sợi ORF5 của sản phẩm PCR được xác định với những mồi giống như mồi dùng cho phản ứng khuếch đại nestedPCR. -Trình tự ORF7 được xác định bằng mồi R133(5' TCGCCCTAATTGAATAGGTGACTC 3') và F132 (5' GTGCTGGGCGGCAAACGAGCTGGT 3'),(Drew et al.1997 ) Những trình tự được tập hợp bằng việc sử dụng SeqMan (Lasergene program package DNASTAR Inc). Phản ứng RT-nPCR và chiến lược giải trình tự được mô tả ở trên đã cho phép việc xác định một phần trình tự ORF5 (432 nucleotid tương ứng từ vị trí 97-528 của ORF5) và toàn bộ trình tự ORF7. Tất cả những trình tự được ghi nhận trong nghiên cứu này được đưa vào ngân hàng gen. . 11 Table 1. Sequence summary 12 -CLUSTAL X được dùng để sắp xếp trình tự và tỉ lệ đồng hóa/dị hóa được ước lượng với TREE-PUZZLE 5.0(tỉ lệ biểu diễn sự biến đổi qua lại giữa các nucleotide trong trình tự). Những tỉ lệ này được sử dụng để đưa vào chương trình DNADIST của gói (package) PHYLIP để thành lập khoảng cách di truyền, nó là một sự ước lượng cho số lượng nucleotide thay thế cho mỗi vị trí, giữa cặp trình tự. Những sự tính toán DNADIST được dựa vào mô hình thay thế F48, đồng hóa và dị hoá xuất hiện những tỉ lệ khác nhau. Dựa vào khoảng cách chất nền (matrix), cây sinh dòng được xây dựng phù hợp với phương pháp Fitch-Margoliash, dùng chương trình DNADIST của gói PHYLIP.Độ tin cậy của việc lấy mẫu được thực hiện trong 100 bản sao bộ dữ liệu để đánh giá những giới hạn tin cậy của mô hình nhánh. IV. Kết quả IV.1. Cơ sở địa lý cho sự đa dạng của PRRSV ở Châu Âu. -Tổng số 22 trình tự ORF5 không hoàn chỉnh đại diện cho dòng PRRSV gây bệnh đã được xác định: 15 từ Ba Lan, 2 từ Đức, 1 từ Anh và 4 từ Lithuania. Hơn nữa, hiện nay hai vaccin nhược độc chủng Châu Âu có thể được dùng , Porcilis PRRS (Porcilis PRRS > 86-98%,) và Pyrsvac183 đã được giải trình tự. Dựa vào 24 trình tự mới ORF5, và những trình tự ORF5 chủng Châu Âu được chọn lọc có sẵn trong ngân hàng gen, một cây sinh dòng được xây dựng. Cây sinh dòng cho thấy một nhóm kín của những trình tự từ Netherland, Anh, Pháp và Belgium gần trình tự ORF5 Lelystad nguyên thủy. Nó đại diện một dòng của Hà Lan phân lập từ năm 1991. Tất cả những trình tự trong nhóm kín giống Lelystad (Lelystad-like) thì có thể từ năm 1991-1992. Một vài nhóm nhỏ khác trong cây sinh dòng có thể được giải thích bởi dịch tể học: Ví dụ: PL9 và PL11 từ những nông trại có sự trao đổi những con heo. LT2 và LT4 từ hai nông trại gần nhau về mặt địa lý. PL2,PL7 và PL15 từ một nông trại nhưng khác biệt về thời gian. -Một vài nhóm không có sự giải thích rõ ràng về mặt địa lý cũng không về mặt thời gian cũng như về mặt dịch tễ học. Ví dụ: nhóm có chứa ES1 (Tây Ban Nha, 1992) và PL12 (Ba Lan, 2000). 13 Fig 5:Phylogenetic tree of EU-type ORF5 sequences. The tree was made with the FITCH program of the PHYLIP package. -Những trình tự từ Tây Ban Nha, nhưng nhất là Đan Mạch, Cộng Hòa Czech và Ý thì khá khác biệt từ nhóm kín giống Lelystad, như đã được ghi nhận trước đây. Bởi vì một vài trình tự củaTây Ban Nha, và hơn nữa trình tự đơn của Đan Mạch và của Ý đã thu được trong năm 1991-1992, điều này đã chỉ ra rằng những nước khác nhau có thể chứa những chủng PRRS khá khác nhau tại mọi thời điểm. Tuy nhiên, việc xác định những 14 trình tự bắt đầu từ khi dịch bệnh xuất hiện ở các nước Châu Âu thì cần thiết để xác định những trình tự này là chung, hoặc duy nhất ở Đan Mạch, Ý và Tây Ban Nha.Ở Ba Lan, PRRSV được phát hiện sớm hơn vào năm 1994, và trình tự đã bắt nguồn từ khi dịch bệnh bùng nổ đầu tiên ở Ba Lan và được gọi là Bie94. Bei94 không cùng nhóm với nhóm giống Lelystad (Lelystad-like) , và cũng không cùng nhóm với ‘Lek’, một nhóm phân lập khác ở Ba Lan từ 1994. Do đó, nó xuất hiện như một quy luật chung, dựa vào những trình tự từ Nhật Bản, Ý, Đan Mạch và Ba Lan, nhiều nước Châu Âu khác đã có những dòng PRRS khác nhau lúc dịch bệnh bùng nổ, mà đa dạng di truyền của PRRS ở Châu Âu có một cơ sở địa lý. Điều quan trọng, cơ sở địa lý này không thể được giải thích bằng sự tiến hóa của một tổ tiên chung PRRS dòng Châu Âu sau dịch bệnh bùng nổ.Những PRRS phân lập rất khác nhau có sự xuất hiện độc lập nhưng phần lớn xuất hiện đồng thời ở các nước Châu Âu khác nhau. (hình 1: so sánh NL1, ES1, ES2, DK1, IT1, tất cả từ năm 1991-1992, PL1 và PL2 từ năm 1994). IV.2. Trình tự PRRS của Lithuania đa dạng khác thường. -Dựa vào hình thức phân tích đơn giản nhất, việc xem xét tỉ lệ nucleotide giống nhau từ hai trình tự Châu Âu khác biệt nhất trong bộ dữ liệu là ‘Nie’ từ Ba Lan-PL9 và ‘Aus’ từ Lithuania-LT1. ‘Nie’ và ‘Aus’ đã cho thấy chỉ có 71.5% nucleotide giống nhau giữa chúng. Ngoại trừ trình tự Polish và Lithuania từ bộ dữ liệu, những trình tự Châu Âu khác biệt nhất là ‘2156’ (IT1’ và ‘Olot/91’ (ES1), chúng có 82.4% nucleotide giống nhau . Do đó, những trình tự Polish và Lithuania đã mở ra hiểu biết về vùng đa dạng của PRRS chủng Châu Âu. -Khi việc phân tích bị giới hạn bởi những trình tự từ năm 2000, hai trình tự khác biệt nhất trong bộ dữ liệu là ‘Sid’ từ Lithuanian và ‘Krz’ từ Ba Lan (LT2 và LT3). ‘Sid’ và ‘Krz’đã cho thấy chỉ có 72.2% nucleic acid giống nhau giữa chúng. Tuy nhiên, những trình tự Lithuania dường như khác so với trình tự của kiểu gen Châu Âu khác đã ghi nhận trước đó ( LT1-LT4) . Xa hơn, sự đa dạng cao giữa những trình tự Lithuanian như giữa vài trình tự Châu Âu khác. IV.3.Dấu vết phân tích trình tự tổ tiên chung cho kiểu gen Châu Âu và Châu Mỹ. -Để thấy được những trình tự khác biệt nhất như thế nào từ Lithuanian được đặt trong phả hệ EU-US PRRSV, một cây sinh dòng mới được xây dựng. Hơn nữa nó bao gồm một chọn lựa những trình tự ORF5 từ các 15 nước châu Âu trong nghiên cứu hiện nay, bao gồm cả Lithuania, dưới 64% giống nhau ở mức độ nucleotide và dưới 70% ở mức độ amino acid so với những trình tự US-ORF5, và vì vậy hiểu rõ về chủng virus đa dạng khác thường của Lithuania liên kết về phía trên nhánh trong EU-US. Kiểu nhánh này có sự hỗ trợ độ tin cậy cao. Để nghiên cứu xa hơn điều phát hiện này, chúng tôi xác định toàn bộ trình tự ORF7 cho PL8, PL9, LT1, và LT2. Một cây sinh dòng dựa vào trình tự ORF7 đã chứng minh kiểu nhánh tìm thấy cho bảng phả hệ ORF5 mặc dù có sự hổ trợ độ tin cậy thấp. Kiểu nhánh giống nhau được quan sát chung cho cả ORF5 và ORF7 ngoại trừ khả năng duy nhất về vị trí của những mẫu của Lithuania là một kết quả tái tổ hợp tổ tiên giữa chủng Châu Âu và Châu Mỹ của PPRSV. Nhánh sinh dòng duy nhất của trình tự ORF5 như là trình tự ORF7 được chứng minh bằng giá trị độ tin cậy cao, đề nghị rằng những trình tự ở châu Âu hiện nay thì giống US-PRRSV hơn EU-PRRSV. 16 Fig 6: Phylogenetic trees of EU-type and most diverse of US-type PRRSV sequences. The large tree (A) depicts the phylogenetic relationship of the ORF5 sequences. The small tree (B) was based on the ORF7 sequences. V.Thảo luận: -Từ khi dịch bệnh bùng nổ trong những năm sau thập niên 80, PPRSV vẫn tiếp tục là nguyên nhân chính gây thiệt hại kinh tế ở các nông trại heo. 17 Ở Bắc Mỹ, sự bùng nổ dịch bệnh gần đây của PRRSV không điển hình đã đề nghị trách nhiệm với sự bùng nổ của các dòng PRRS mới , việc chống lại các vaccin hiện nay dường như không cung cấp sự bảo hộ . Về mặt lý thuyết, viễn cảnh này không bị giới hạn ở Bắc Mỹ, và kiến thức về đa dạng di truyền của EU-PRRSV có thể cải thiện điều kiện đánh giá các trường hợp tương tự có khả năng xảy ra ở Châu Âu. Dự đoán bao gồm cả các nước Đông Âu trong cộng đồng Châu Âu có sự liên quan một cách đặc biệt trong khía cạnh này, vì dữ liệu có giá trị đưa ra giả thiết rằng Nga và Cộng Hòa Séc có thể có các chủng PRRSV mà có sự khác biệt so với những phát hiện đó ở các nước Châu Âu khác. Cho đến bây giờ hay lúc đó, số lượng những trình tự được ghi nhận từ Cộng Hòa Séc có sự liên hệ thấp với các trình tự của Nga nên sự hiểu biết của chúng tôi vẫn chưa đưa vào cơ sở dữ liệu chung. Vì thế, nghiên cứu hiện nay đã đảm bảo khám phá xa hơn về đa dạng trình tự của PRRSV ở Đông Âu bằng việc phân tích các trình tự của PRRSV đầu tiên từ Ba Lan và Lithuania. Khám phá chính trong nghiên cứu hiện tại là Lithuania có dòng PRRSV đa dạng khác thường. Tất cả bốn trình tự trong huyết thanh heo của Lithuania được lấy từ sản phẩm RT-PCR. Theo ý kiến của chúng tôi, điều này làm nó giống các trình tự của Lithuania được lấy từ toàn bộ virion của PRRSV. Chúng tôi lấy những trình tự của virus trực tiếp từ trình tự cả hai sợi của sản phẩm PCR không tạo dòng để giảm tối thiểu việc tạo Taq nhân tạo. Tuy nhiên, do có sự ngạc nhiên lớn về các trình tự của Lithuania, chúng tôi tiến hành thêm các đối chứng để điều tra RTPCR và kế hoạch giải trình tự: -Đầu tiên, lặp lại RT-PCR và giải trình tự trong các mẫu huyết thanh được chọn lọc và xác định trình tự DNA. -Bước thứ hai: giải trình tự ORF5 cũng như là ORF7 cho virus ở Lithuania, và thu được nhóm sinh dòng xác định. Xa hơn, chúng tôi đánh giá sự đa dạng của PRRSV Lithuania giống với sự đa dạng của các dòng PRRSV ở Nga, trình tự nucleotid của ORF7 có sự khác biệt tới 16% so với virus Lelystad đã được ghi nhận. -Những trình tự của Lithuania cho thấy có sự ngạc nhiên lớn và kiểu nhánh bất thường trong sinh dòng EU-US. Trong đó, chúng dường như có nguồn gốc từ trình tự tổ tiên giống Châu Mỹ (US-like) hơn được thấy trước đây ở Châu Âu. Sự giải thích này được chứng minh bằng sự quan sát kích thước protein ORF7 của PRRSV ở Lithuania (124 residues) là trung gian giữa kích thước của protein ORF7 của chủng Châu Âu đầu tiên (128 residues ) và chủng Châu Mỹ (123 residues) (hình 3b). Tuy nhiên, các trình tự ORF7 của Lithuanian cung cấp ví dụ đầu tiên về đa hình kích thước có thể xảy ra trong protein ORF7 của dòng PRRSV phân lập của 18 chủng Châu Âu. Khám phá này có sự liên quan rõ ràng, ví dụ: sử dụng kích thước ORF7 sau phản ứng RT-PCR để phân biệt giữa các chủng virus. -Trong đoạn ORF5 được giải trình tự, chúng tôi phát hiện một vài dòng EU-PRRSV có 71.5% nucleotid giống nhau (PL9 và LT1). -Những nghiên cứu trong đa dạng di truyền của EU-PRRSV có thể bao gồm một số lượng phân lập lớn từ tất cả các nước Châu Âu và ưu tiên giai đoạn từ năm 1991 (virus Lelystad phân lập là PRRSV phân lập đầu tiên) đến nay. Rõ ràng, điều này không thể thực hiện. Do đó, việc mô tả đúng về đa dạng trình tự của EU-PRRSV sẽ có thể phát triển dần dần, do có liên tiếp nhiều nghiên cứu bổ sung. Nghiên cứu hiện nay về tính đa dạng chủ yếu ở Châu Âu, dòng PRRSV của chủng Châu Âu đã bổ sung vào tính đa dạng của EU-PRRSV trong nghiên cứu trước đó (Suarez et al., 1996 ; Oleksiewicz et al., 2000 ; Indik et al., 2000 ; Forsberg et al., 2001 , 2002 ). Hướng mô tả dường như cho thấy các dòng PRRS thay đổi khác nhau không thể là một đặc trưng riêng biệt ở bất kì một quốc gia nào, nhưng là một quy luật chung ở Châu Âu, ngoại trừ các nước như là Hà Lan, Belgium, Pháp và Anh nơi hiện diện của nhiều dòng PRRSV có quan hệ gần gũi ( Lelystad-like) có thể được giải thích bằng con đường thương mại. Figure 5 Sequence alignment of Lelystad Virus và Porcilis®PRRS VI. Kết luận Sự đa dạng của PRRSV ở Châu Âu do nhiều nguyên nhân: - Sự tiến hóa của một tổ tiên chung PRRS dòng Châu Âu sau dịch bệnh bùng nổ. -Một vài nhóm có thể được giải thích bằng dịch tể học và về mặt địa lý. -Có sự đa dạng lớn giữa các trình tự của Lithuania. 19 - Những trình tự ở châu Âu hiện nay thì giống US-PRRSV hơn EUPRRSV. VII. Tài liệu tham khảo Công nghệ sinh học trong thú y. Nguyễn Ngọc Hải. www.porcilis-prrs.com/pathogensis prrs.asp 20
- Xem thêm -