Tài liệu Bệnh lở mồm long móng

  • Số trang: 31 |
  • Loại file: PDF |
  • Lượt xem: 137 |
  • Lượt tải: 0
tranvantruong

Đã đăng 3224 tài liệu

Mô tả:

Bệnh lở mồm long móng
TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC Tiểu luận: Sinh viên thực hiện : Lê Hoàng Lâm MSSV GVHD : PGS.TS Nguyễn Ngọc Hải : 06126069     PHẦN I: ĐẶT VẤN ĐỀ Nước ta là một nước có nền nông nghiệp phát triển. Trong đó ngành chăn nuôi đóng một vài trò quan trọng trong cơ cấu kinh tế của nền nông nghiệp. Giai đoạn 20012006, ngành chăn nuôi có mức tăng trưởng bình quân 7-8%/năm; năm 2007 chỉ đạt 4,6% và năm 2008 đạt 6%.Theo số liệu thống kê 01.10.2008, Việt Nam có gần 2,90 triệu con trâu; 6,34 triệu con bò; 26,701 triệu con lợn; 247,320 triệu con gia cầm; 1,48 triệu con dê, cừu; 121 ngàn con ngựa. Tỷ trọng ngành chăn nuôi trong Nông nghiệp đạt 2024,5% giai đoạn 2001-2006, năm 2007 đạt 24,4% và năm 2008 đạt 27%. Bên cạnh đó do vị trí địa lí , Việt Nam nằm trong vùng khí hậu nhiệt đới, độ ẩm cao là điều kiện thuận lợi cho một số dịch bệnh phát triển. Trong số một số bệnh thường gặp, chúng tôi đặc biệt chú ý đến bệnh lở mồm long móng. Đây là một bệnh thường xảy ra trên đàn vât nuôi gây thiệt hại to lớn đối với nền kinh tế nước ta. Trâu bò bị bệnh lở mồm long móng thì phải nghỉ cày kéo, ảnh hưởng đến thời vụ gieo trồng. Khi khỏi bệnh phải nghỉ hàng tháng mới lấy lại sức.Những con bị long móng phải đi khập khễnh 2- 3 tháng, có khi thành tật, phải giết thịt.Do bệnh tích của bệnh lở mồm long móng thể hiện ở miệng, ở vùng móng và ở vùng vú .Khi gia súc bị bệnh thì núm vú, bầu vú bị sưng, da xung quanh có mụn đỏ và đau, 2- 6 ngày mụn vỡ tạo thành vết loét dễ gây viêm vú nhiễm trùng. Bệnh do virus thuộc giống Aphthovirus, họ Picornaviridae có 7 type virus gây bệnh lở mồm long móng: O, A, C, S.A.T–1, S.A.T- 2, S.A.T- 3 và ASIA-1và hơn 60 subtype. Hiện nay ở nước ta có 2 type gây bệnh là A, O. Đây là bệnh truyền nhiễm cấp tính lây lan rất nhanh và rất mạnh, rộng cho nhiều loài gia súc, loài nhai lại, heo và người.Các type virus lở mồm long móng phân bố không đều trên thế giới: các type SAT thường ở khu vực châu Phi, type O và A ở khu vực Châu Á,Viễn Đông, Nam Mỹ. Type C ít hơn chỉ có ở khu vực Ấn Độ và Type Asia1 chỉ có ở khu vực Nam Á. Các chủng virus lở mồm long móng biến đổi rất nhiều và do sự phân bố rộng, phức tạp của chúng nên thường gặp nhiều khó khăn trong việc xác định nguồn gốc lây lan của chúng. Vì vậy, để kiểm soát dịch bệnh lở mồm long móng, tránh việc lây lan bệnh trên diện rộng thì nhất thiết phải sử dụng những loại vacxin thích hợp cho đàn vật nuôi. Chính bởi vì lí do trên, nên chúng tôi thực hiện tiểu luận “ Cây sinh dòng virus lở mồm long móng SEROTYPE A”. Mục đích của tiểu luận giúp chúng ta có cái nhìn tổng thể về virus lở mồm long móng serotype A, giúp các nhà quản lí có kế hoạch phòng chống dịch bệnh một cách hiệu quả ngay từ khi mới bùng phát.     PHẦN II:TỔNG QUAN 2.1.Bệnh lở mồm long móng 2.1.1. Nguyên nhân: Do virus thuộc giống Aphthovirus, họ Picornaviridae có 7 type virus gây bệnh lở mồm long móng: O, A, C, S.A.T–1, S.A.T- 2, S.A.T- 3 và ASIA-1. Hiện nay ở nước ta có 2 type gây bệnh là A, O và Asia-1. 2.1.2 Sức đề kháng của virus - Virus có sức đề kháng mạnh. Ở 600C tồn tại 5-15 phút, ở 1000C virus sẽ chết, từ 0-40C tồn tại 425 ngày, trong đất ẩm virus sống hàng năm, trong thịt ướp lạnh virus tồn tại khá lâu trong phân virus tồn tại 7 ngày, nước tiểu virus tồn tại 39 ngày. - Virus dễ bị tiêu diệt bởi các loại thuốc sát trùng của công ty ANOVA như: NOVAMC.A30, NOVACIDE, NOVADINE, NOVASEPT, NOVAKON và các loại khác như: NaOH 1% diệt virus từ 1-10 phút, formol 2%, nước vôi từ 5-10%. 2.1.3. Phương thức truyền lây - Bệnh lây qua đường tiêu hóa, đường hô hấp và sinh dục là đường xâm nhập phụ. Sự truyền bệnh trực tiếp do nuôi nhốt chung, chăn thả chung… hoặc lây gián tiếp qua thức ăn, nước uống, dụng cụ chăn nuôi mang mầm bệnh, người, phương tiện vận chuyển. - Loài mắc bệnh: Trâu bò mắc bệnh nhiều nhất, rồi đến các loài sau: heo, dê cừu, thú hoang dã… Bệnh có thể lây qua cho người, các loài một móng, ngựa, gia cầm không mắc bệnh này. 2.1.4. Triệu chứng Thời gian nung bệnh từ 2-7 ngày, trung bình là 3-4 ngày, gồm 3 thể bệnh 2.1.4.1. Thể thông thường - Bệnh hay gặp ở vùng nhiệt đới, thú ủ rũ, lông dựng, da mũi khô, thú sốt cao 4041 0C kéo dài 3 ngày. - Xuất hiện các mụn nước ở da, vành móng kẻ chân, lưỡi, vú làm thú kém ăn, nhai khó khăn. 2    - Ở miệng: lưỡi có mụn to ở đầu lưỡi gốc lưỡi ở hai bên lưỡi, xoang trong miệng trong má, lỗ chân răng, môi có mụn lấm tấm bằng hạt ké, hạt bắp. Sau đó mụn vỡ và tạo thành các vết loét đáy nhỏ và phủ màu xám. Nước dãi chảy nhiều như bọt xà phòng. - Ở mũi: niêm mạc có mụn nước, đặt biệt là vành mũi có mụn loét, nước mũi lúc đầu trong sau đục dần. - Ở chân, kẽ móng có mụn nước từ trước ra sau, mụn vỡ làm long móng. - Ngoài da : xuất hiện các mụn loét ở vùng da mỏng như bụng, bẹn, vú, ở đầu núm vú … Thú giảm sản lượng sữa, sau sữa đổi thành màu vàng, vắt sữa khó gây viêm vú. - Sau khi hàng loạt mụn nước vỡ dần sẽ dẫn đến nhiễm trùng máu, nhiễm trùng da, thú sốt cao, suy nhược dần. 2.1.4.2. Thể biến chứng Những biến chứng xảy ra khi điều kiện vệ sinh, chăm sóc kém làm mụn vỡ dẫn đến nhiễm trùng, chân bị long móng, thối móng, thối xương làm thú què. Vú thì bị viêm tắt sữa. Các mụn khác vỡ sẽ gây nhiễm vi khuẩn kế phát, bại huyết. Bệnh lỡ mồm long móng ghép với các bệnh ký sinh trùng hay vi khuẩn khác có sẵn trong máu (tiêm mao trùng, lê dạng trùng...) có thể làm con vật mau chóng chết. 2.1.4.3. Thể ác tính Trên bê nghé ngoài triệu chứng sốt cao, thú bị tiêu chảy và chết đột ngột trước khi xuất hiện các mụn nước ở thượng bì do viêm ruột cấp tính, viêm phổi cấp hoặc viêm cơ tim cấp tính. 2.1.5. Bệnh tích Chủ yếu ở đường tiêu hóa như miệng có các vết loét ở lưỡi, lỗ chân răng, hầu, thực quản, dạ dày… Ở đường hô hấp gây viêm phế quản. Bên trong phủ tạng: tim bị viêm cấp, van tim bị sùi hoặc loét, lách bị sưng đen, niêm mạc ruột non ruột già xuất huyết điểm, long móng, rụng xương bàn chân. Khi khỏi bệnh thì ở các vết loét sẽ để lại sẹo. 3    (1) (4) (2) (5) (3) (6) Hình 1.1: Một số hình ảnh triệu chứng, bệnh tích FMD trên bò: (1) Miệng chảy nhiều nước bọt, (2)(3) Vết loét ở lưỡi, (4) Vết loét ở móng (5) Vết loét ở móng bò, (6)) miệng loét ở lưỡi và môi, nưới răng. 2.1.6. Phòng bệnh - Khi phát hiện dịch phải khai báo ngay với các cơ quan thú y và chính quyền địa phương, cách ly thú bệnh, tránh tiếp xúc với thú khỏe và các loài thú khác 4    - Phòng bệnh bằng vệ sinh là rất quan trọng, thường xuyên sát trùng chuồng trại, dụng cụ chăn nuôi, bãi chăn thả, bằng các loại thuốc sát trùng của ANOVA như: NOVAMC.A30, NOVACIDE, NOVASEPT, NOVADINE, NOVAKON. - Khi xảy ra bệnh phải xử lý thật kỹ toàn bộ chuồng trại, dụng cụ chăn nuôi bằng các loại thuốc sát trùng, các gia súc mắc bệnh phải tích cực điều trị phụ nhiễm và tránh lây lan bệnh, xác chết phải được xử lý theo các quy định của ngành thú y. Không được phép bán chạy hoặc tự ý giết mổ bán thịt các gia súc mắc bệnh. - Định kỳ tiêm phòng bệnh lỡ mồm long móng bằng vaccin (1 năm tiêm 1-2 lần tùy theo vaccin). Vaccin dùng nên lựa chọn vaccin đa giá có 2 type O và A - Lịch chủng ngừa: Chủng ngừa lần đầu vào lúc 2 tuần tuổi đối với bê nghé từ mẹ chưa tiêm phòng và 50-70 ngày trên bê nghé từ mẹ đã được tiêm phòng bệnh. Sau 3-4 tuần thì tiêm lại lần 2 để nâng cao miễn dịch. Chủng ngừa định kỳ 6 tháng một lần. 2.1.7. Điều trị Việc điều trị thường không mang kết quả tốt vì là nguồn bệnh sau này sẽ ảnh hưởng đến các đàn heo nuôi kế tiếp. Có thể điều trị các triệu chứng và tăng sức đề kháng cho heo như sau: - Tiêu độc chuồng trại và xung quanh hàng ngày bằng các lọai thuốc sát trùng như NOVADINE, NOVACIDE, NOVASEPT và liên tục cho đến 2 tuần sau khi gia súc được điều trị khỏi bệnh. - Điều trị các vết thương ở miệng: thoa bằng dung dịch NOVADINE hoặc dùng chanh, khế thoa lên các mụn nước ở lưỡi, môi, nướu răng, mỗi ngày thoa 3-4 lần cho đến khi hết mụn nước. - Trong bệnh lỡ mồm long móng chủ yếu là điều trị triệu chứng và kết hợp sử dụng kháng sinh để tránh nhiễm vi khuẩn kế phát. Sử dụng một trong các sản phẩm sau: + NOVA-NORCINE: tiêm bắp 1ml/20kg thể trọng, ngày 1 lần, 4-5 ngày liên tục. + NOVA-GENTASONE 10%: tiêm bắp 1ml/20kg thể trọng, ngày 1 lần, trong 3-4 ngày liên tục. 5    + NOVASONE: tiêm bắp 1ml/12-15kg thể trọng, ngày 1 lần, trong 3-4 ngày liên tục. + NOVA-TETRA LA: tiêm bắp 1ml/20kg thể trọng, 2 ngày tiêm 1 lần. +Sử dụng NOVA PREDNI-C để kháng viêm hạ sốt tiêm bắp liều 1ml/2530kg thể trọng, dùng cho đến khi hết triệu chứng bệnh. Kết hợp sử dụng NOVAB.COMPLEX, NOVA-ATP COMPLEX, NOVASAL để tăng sức đề kháng bệnh và mau hồi phục. 2.2.CẤU TRÚC GENOME CỦA VIRUS LỞ MỒM LONG MÓNG (FMDV) Bộ gen của FMDV là ARN đơn chuỗi (+) gồm 8.5kb, tương ứng với 2,6.106 (dal) có hệ số lắng 146S. Vỏ capsid gồm 4 loại protein vỏ: VP1,VP2, VP3, VP4, mỗi loại gồm 60 copy. VP1 có đặc tính sinh miễn dịch. Genome FMDV gồm 3 phần: Vùng 5’ không dịch mã (5’ UTR- Untranslated Region) mang một đoạn poly C, vùng mã hóa (coding region), vùng 3’ không dịch mã (3’UTR) và vùng không tương đồng (heteropolymeric) và một đuôi poly(A) cần thiết cho sự sao chép virus. 6    Toàn bộ genome của FMDV mã hóa cho một protein đơn. Sau khi dịch mã, protein này được phân cắt thành 4 sản phẩm sơ cấp: Amino terminal L protease, phân cắt ở đầu cuối cacboxyl, P1-2A, tiền chất của protein vỏ; sẽ trải qua giai đoạn polyproteinsau dịch mã với sự tham gia của các protease virus để tạo 1 promoter. 5 copy của promoter sẽ sắp xếp thành một pentamer. 12 pentamer sau đó sẽ sắp xếp với RNA virus để tạo thành một virion. 2B2C ,P3 được phân cắt để tạo thành protein sao chép hoặc protein không cấu trúc: 3A, 3B, 3C, và 3D, polymerase RNA phụ thuộc RNA. Việc phân cắt các polyprotein ban đầu đều có sự tham gia của các protease do virus mã hóa, sự phân cắt này diễn ra cực kì nhanh chóng. Việc chuẩn đoán bệnh FMD được thực hiện theo các phương pháp chuẩn hóa được quy định bởi tổ chức dịch tễ thế giới OIE (Office International des Epizooties). Các phương pháp chuẩn đoán bao gồm: Xác định tác nhân gây bệnh ( phân lập, ELISA, xác định acid nhân virus..). Trong mục đích chuẩn đoán tác nhân gây bệnh, loại mẫu tốt nhất là mẫu biểu mô tại vùng mụn nước chưa bị vỡ hoặc chỉ mới bị vỡ. Mẫu phải được bảo quản cẩn thận trong dung dịch glycerol pha với dung dịch đệm photphat pH 7,2-7,6 và kháng sinh; mẫu được giữ trong điều kiện lạnh để vận chuyển về phòng thí nghiệm, tốt nhất là giữ đông lạnh ở -70oC 2.3.RT-PCR RT - PCR là phản ứng sinh tổng hợp DNA trên khuôn mẫu RNA, do một DNA polymerase là reverse transcriptase (RT enzyme) xúc tác. Tổng hợp cDNA (complementary DNA) trên khuôn RNA gồm ba bước : - Bước 1: Chiết xuất RNA tổng số, trong đó có RNA của virus. - Bước 2: Tổng hợp sợi cDNA thứ nhất nhờ reverse transcriptase. Tùy thuộc vào mục đích thí nghiệm, primer để tổng hợp sợi DNA đầu tiên có thể được lai chuyên biệt với một gen đích hay có thể kết hợp với toàn RNA. Có ba loại primer có thể dùng trong tổng hợp cDNA. (1) Oligo (dT): kết hợp với đuôi poly A của mRNA của động vật hữu nhũ. (2) Primer chuyên biệt với trình tự đã chọn trên RNA đích. (3) Random hexanucleotide: có thể khởi đầu sự tổng hợp cDNA ở nhiều điểm trên RNA khuôn mẫu tạo ra nhiều đoạn bản sao của toàn phân tử RNA. Chúng hữu dụng khi RNA đích là quá dài hay chứa quá nhiều cấu trúc bậc hai đến nỗi sự tổng hợp cDNA không bắt đầu hiệu quả bởi oligo (dT) hay primer chuyên biệt. Trong hầu hết trường hợp, mục đích của những nhà nghiên cứu là tạo cDNA ban đầu dài và chứa nhiều thành phần của phân tử bổ sung với trình tự RNA đích. Do đó primer chuyên 7    biệt là lựa chọn tốt nhất. Tiếp đến là oligo (dT) cũng tốt cho sự lựa chọn. Random hexamer không chuyên biệt và tạo ra những phân tử cDNA dài, ngắn khác nhau được sử dụng khi những phương pháp kia không hiệu quả. - Nhân sợi cDNA thứ nhất lên nhiều bản bằng PCR. Giai đoạn này gồm có 3 bước như sau: + Denature (biến tính): Chuyển dây đôi thành dây đơn + Annealing (bắt cặp): Primer gắn vào vị trí trên dây khuôn mẫu có mã đối xứng với nó. + Extension (kéo dài): Kéo dài chuỗi mới nhờ enzyme polymerase. Ba giai đoạn này lặp lại nhiều lần, để tạo nhiều sản phẩm khuếch đại. Ba giai đoạn này xảy ra trong điều kiện nhiệt độ khác nhau (ví dụ: 94oC, 55oC, 72oC) với sự trợ giúp của enzyme polymerase. Sự lặp lại theo chu kỳ thường xảy ra khoảng 30 lần để làm tăng lượng sản phẩm. Độ dài của sản phẩm PCR tùy thuộc vào số đoạn và chiều dài của primer trong phản ứng, điều kiện chất buffer, nhiệt độ bắt cặp của primer. Reverse transcriptase, là một DNA polymerase phụ thuộc vào RNA làm khuôn mẫu. Hiện có hai loại Reverse transcriptase được giới thiệu trên thị trường : - AMV (Avian myeloblastosis virus) Reverse Transcriptase. - Mo - MLV Reverse Transcriptase (Moloney murine leukemia virus). Mo - MLV Reverse Transcriptase đ ợc dùng nhiều hơn đối với thực vật. Để tổng hợp DNA cần một đoạn primer gắn trên mẫu RNA làm chỗ khởi động. Chú ý, khi làm việc với RNA cần cẩn thận để tạo môi trường không có ribonuclease. Ribonuclease hay RNAse có thể ở mọi nơi. RNAse rất bền và khó bị bất hoạt. Cần duy trì môi trường không có RNAse từ giai đoạn tinh sạch RNA cho đến suốt quá trình phân tích. 2.4. PHƯƠNG PHÁP GIẢI TRÌNH TỰ Hiện nay, với trình độ khoa học ngày càng phát triển, phương pháp xác định trình tự nucleotide ra đời đóng vai trò quan trọng trong nghiên cứu cũng như ứng dụng trong thực tế. Hai phương pháp xác định trình tự chính là phương pháp hoá học của Maxam Gilbert (1977) và phương pháp enzyme học của Sanger và cộng sự (1977). Dù rất khác nhau về nguyên tắc, hai phương pháp này có một số điểm chung: hình thành một tập hợp nhiều oligonucleotide có chiều dài khác nhau, mỗi oligonucleotide có xác suất xuất hiện bằng nhau trong phản ứng. Các trình tự này sau đó được phân tách dựa vào kích thước bằng phương pháp điện di trên gel polyacrylamide có khả năng phân tách hai trình tự chỉ cách nhau 1 nucleotide. Kết quả được đọc trên bảng phóng xạ tự ghi hoặc nhờ một máy dò tự động. 8    2.4.1.Nguyên tắc hóa học : Phương pháp Maxam và Gilbert Phương pháp này dựa vào sự thủy giải đặc trong phân tử DNA cần xác định trình tự bằng phương pháp hoá học. Trước hết các phân tử DNA đ ợc đánh dấu bằng 32 chia thành 5 phân đoạn, mỗi phân đoạn chịu một xử lý hoá học chuyên biệt có khả năng làm biến đổi đặc trong một loại nucleotide và sau đó cắt phân tử DNA ngay nucleotide ấy. Năm nhóm nucleotide bị tác động là: G, A, C, G+A, T+C. Kết quả của các xử lý hoá học là sự hình thành năm tập hợp nucleotide, các oligonucleotide trong một tập hợp có kích thước khác nhau nhưng đều chấm dứt tại cùng một loại nucleotide. Cuối cùng năm phân đoạn trên được đem phân tách trên gel polyacrylamide. Vị trí của các oligonucleotide trên gel tương ứng với kích thước của chúng và đuợc phát hiện nhờ đầu có đánh dấu phóng xạ. Kết quả được đọc trên bảng phóng xạ tự ghi. 2.4.2. Phương pháp enzyme học thông qua việc sử dụng các dideoxynucleotide của Sanger. Phương pháp này dựa vào sự tổng hợp nhờ enzyme DNA polymerase mạch bổ sung cho trình tự DNA mạch đơn cần xác định. Đặc trưng của phương pháp là ngoài bốn loại nucleotide thông thường còn sử dụng thêm bốn loại dideoxynucleotide là những deoxynucleotide trong đó nhóm 3’OH được thay thế bằng H. Điều này khiến các dideoxynucleotide không còn khả năng hình thành các nối phosphodiester và do đó sẽ làm ngừng quá trình tổng hợp. Trình tự DNA cần xác định cần phải được tạo dòng trong một vector mạch đơn (phage M13). DNA polymerase sử dụng có thể là đoạn Klenow của DNA polymerase I, Taq polymerase hay Sequanase. Sự tổng hợp mạch mới bắt đầu bằng từ một mồi bắt cặp với một trình tự chuyên biệt trên phage M13, với sự hiện diện của bốn loại nucleotide trong đó một loại được đánh dấu đồng vị phóng xạ (35S). Phản ứng tổng hợp được tiến hành trong bốn phân đoạn riêng. Người ta lần lượt cho vào mỗi phân đoạn một trong bốn loại dideoxynucleotide với hàm lượng rất nhỏ. Do hàm lượng thấp nên thỉnh thoảng mới có một dideoxynucleotide được sử dụng vào phản ứng tổng hợp một olidonucleotide và lập tức sự tổng hợp oligonucleotide đó ngừng lại. Tính xác suất thì trong mỗi phân đoạn sẽ có mặt tất cả các cỡ oligonucleotide ứng với tất cả các nucleotide cùng loại hiện diện trên trình tự DNA. Ví dụ: nếu trình tự DNA cần xác định là AATCGATAGGCTTGCATG thì trong phân đoạn có mặt dideoxynucleotide ddC sẽ có sự tổng hợp các oligonucleotide sau: AATC AATCGATAGGC AATCGATAGGCTTGC Sau đó bốn phản ứng tổng hợp sẽ được đem phân tách trên gel polyacrylamide và kết quả được đọc trên bản phóng xạ tự ghi. 9    2.4.3.Giải trình tự bằng máy đọc tự động Hiện nay, đã có những phương pháp cải biên từ phương pháp của Sanger như phương pháp giải trình tự bằng máy tự động qua cloning và trực tiếp từ sản phẩm PCR. Ở đây, chúng tôi tiến hành giải trình tự trực tiếp từ sản phẩm PCR bằng máy đọc trình tự tự động ABI PRISM 3100 của công ty AB (Applied Bioscience). Máy hoạt động dựa trên nguyên tắc của Sanger nhưng có một số cải biên. Trong kỹ thuật này người ta không đánh dấu bằng các đồng vị phóng xạ mà bằng hoá chất – các fluochrome. Mỗi loại dideoxynucleotide được đánh dấu bằng một fluochrome có màu khác nhau. Như vậy, tất cả các oligonucleotide cùng chấm dứt tại một loại dideoxynucleotide sẽ có cùng một màu. Sau khi điện di trên gel polyacrlamide, kết quả sẽ được đọc qua một hệ thống vi tính. Trước hết, đoạn DNA cần xác định trình tự được khuếch đại bằng phương pháp PCR. Sau đó hai mạch của phân tử DNA đựợc tách rời nhau. Mỗi mạch được bắt cặp bởi một mồi (có thể là mồi dùng cho phản ứng PCR hay một mồi nằm bên trong đoạn DNA). Phản ứng tổng hợp xảy ra tương tự như trong các phương pháp enzyme học sử dụng dideoxynucleotide. Phương pháp đọc trình tự trực tiếp từ sản phẩm PCR chỉ sử dụng khi vùng cần xác định trình tự đã biết tr ớc và ứng dụng chủ yếu là nhằm phát hiện nhanh một đột biến điểm. PHẦN III:VẬT LIỆU VÀ PHƯƠNG PHÁP 3.1.Vật liệu Trong nghiên cứu này, chúng tôi nghiên cứu trên 82 chủng virus type A trong đó có 80 chủng được phân lập và phục hồi từ những ổ dịch khác nhau trên 15 bang của Ấn Độ từ 1984-2000 và 2 chủng đã có vaccine IND/490/97 và A10-Indian Vaccine Strain (A10-IVS) . Những chủng này vẫn được lưu giữ tại kho dữ liệu quốc gia của Ấn Độ về FMDV 3.2.Phương pháp Quy trình chung cho quá trình xây dựng cây sinh dòng của 82 chủng FMDV 10    3.2.1. Nuôi virus-và thu hoạch tế bào 82 chủng virus được cấy chuyền 3-5 lần trong môi trường tế bào một lớp BHK21(Baby hamster kidney cell line ) . Ta tiến hành thu các tế bào nhiễm bệnh nổi lên trên mặt môi trường đem cất ở 70oC trước khi sử dụng 3.2.2.Li trích RNA tổng số RNA tổng số được ly trích bằng bộ kít li trích RNA (Qiagen) 3.2.3. Chạy RT-PCR và giải trình tự Phản ứng reverse transcriptase (RT) tạo cDNA - Thành phần phản ứng RT: • • • • Primer (NK61,5’GACATGTCCTCCTGCATCTG-3’) AMV Reverse Transcriptase RNA tổng số Hỗn hợp phản ứng cuối cùng 20pmol 1 µl 10 µl 20 µl Hỗn hợp phản ứng được ủ tại 48oC trong 1h để tổng hợp cDNA. Tiếp theo ủ tại 95oC trong 5 phút để bất hoạt enzym. Sau đó chạy phản ứng PCR khuếch đại các cDNA vừa mới tạo thành từ phản ứng Reverse Transcriptase Phản ứng khuếch đại PCR của những cDNA này được tiến hành sử dụng Hotstar PCR kit(Qiagen) và 20 pmol của mỗi primer( NK61 và 11    pA-1C562,5’TACCAAATTACACACGGGAA) theo hướng dẫn được cung cấp. Phản ứng được thực hiện theo chu trình nhiệt: chu kỳ đầu tiên biến tính tại 95oC trong 15 phút theo sau bởi 35 chu kỳ theo chu trình: biến tính tại 94oC trong 1 phút, bắt cặp tại 55oC trong 1 phút, kéo dài tại 72oC trong 1.5 phút. Chu kì cuối cùng kéo dài tại 72oC trong 10 phút. Sau đó sản phẩm PCR đem điện gi và quan sát dưới tia UV. Trước khi giải trình tự sản phẩm PCR được tinh sạch bằng QIAquick kit(QIAGEN). Sản phẩm PCR sau khi được tinh sạch đem đi giải trình tự với fmol Cycle Sequencing kit(promega) và primer Cy5 đã được đánh dấu (antisense 5’GAAGGGCCCAGGGTTGGACTC). Trong một vài trường hợp, một primer đánh dấu được thêm vào (pA-1C612,TAGCGCCGGCAAAGACTTTGA) được sử dụng để hoàn thành việc giải trình tự gen 1D. Việc giải trình tự được thực hiện trên hệ thống phân tích ALFexpress II DNA (pharmacia) 3.2.4. Phân tích dữ liệu sau khi giải trình tự Các trình tự phân tử được so sánh dựa trên phần mềm Clustal W sẵn có trong chương trình OMIGATM (Oxford MolecularLtd,England) . Phân tích cây sinh dòng được thực hiện bằng phần mềm PHYLIP version 3.5c . Trong quá trình phân tích khoảng cách tiến hóa cũng được tính toán bằng phần mềm DNADIST. Khoảng cách nền được sử dụng để tạo cây họ hàng bằng phần mềm NEIGHBOR. Cây cuối cùng được vẽ bằng TreeView 1.5.2. Những cây địa hình được đánh giá bằng việc phân tích mối quan hệ từ 100 bản sao của dữ liệu gốc được thiết lập trong chương trình BOOTSTRAP, DNADIST, NEIGHBOUR và CONSENSE . O2/Brescia/1947 được kể đến trong phân tích như một loài xa lạ.Một sự so sánh độc lập khác của trình tự nucleotide và cấu trúc phía sau của cây UPGMA được thực hiện bằng chương trình “EpiSeq”( được viết bởi N.J. Knowles, Pirbright Laboratory,UK). Các phân tích được thực hiện trên chương trình DNASTAR (DNASTAR, Inc, Hoa Kỳ). Các trình tự được lấy từ GenBank / EMBL hoặc đã được công bố trước đó để so sánh (nhập số accession hoặc số tham khảo trong dấu ngoặc đơn) A10-Holland (M20715), A10-61 (X00429), A12-119b (J02187), IND 17/77 (AF 204108),A5/Spain/86 (M72587), A5/Tubingen , A24/Pirbright , Iran/4/98 (trình tự cung cấp bởi Drs. N. J. Knowles and R. P. Kitching, IAH, Pirbright), A22/550 Azerbaijan/65 (A22/Azerbaijan/65; X74812), A24/Cruzeiro/Brazil/55 (A24/Brazil/55; K03340), A27/Cundinmarca/Colombia/76 (A27/Colombia/76; K03341), Argentina/79 (K03345), 81/Castellanos/Argentina/87 (Argentina/87; U62255), Madrid (E)/1983 (Madrid/83; M16084), Modena (I)/1984 (Modena/84; M16082), Morocco (MA)/1983 (Morocco/83; M16090), Venceslau/Brazil/76 (Brazil/76; K03344), 4 chủng Trung Quốc (NM/EL/60, NM/ XZ/64, XJ/KT/58, GS/LX/62; AJ131663, AJ131664, AJ131665, AJ131666), A22/Iraq 24/64 , Albania/1996 (Albania/96), Iran/1987, SaudiArabia/1992 (SAU/92),A22/Thailand/1993 (Thailand/93), Thailand/1996 (Thailand/96), Bilbao/Spain/1973 (Spain/73), A1/Bavaria/ 1946 (A1/Bavaria/46), A7(5)/Greece/1954 (A7/Greece/54) , BAN/2/87, Iran/2/97, Iran/ 17/97, MAL/10/97, Turkey/1992 (Turkey/92), Turkey/96 , A5/Westerwald and A32/Venezuela/70 . 12    PHẦN IV:KẾT QUẢ 4.1. Sự phân nhóm kiểu gen của virus Một phần của chuỗi trình tự không thể cung cấp một cách đầy đủ những thông tin trong cây phát sinh loài cho sự phân loại có ý nghĩa của virus. Nhiều nhà nghiên cứu đã đề xuất rằng phải biết ít nhất trình tự 250 nu, nếu không biết trình tự đầy đủ của gen 1D, để suy xét trong việc phân loại dịch tễ phân tử của FMDV. Theo những đề xuất trên, chúng tôi đã phân tích hoàn toàn trình tự gen 1D của 83 chủng virus phân lậ từ Ấn Độ bao gồm cả 3 chủng vacxin (IND 17/77, IND 490/97 and A10-IVS) và 37 trình tự sẵn có trong những dữ kiệu đã được công bố trước đó để xác định sự khác nhau phổ biến giữa những kiểu genotype. Ở đây chúng tôi đã xác định các kiểu gen khi một nhóm được phân lập với độ biến động ít hơn 15%. Những tiêu chí tương tự đã được sử dụng bởi các tác giả khác để phân loại kiểu gen FMDV sử dụng một phần trình tự. Trong cây UPGMA (hình 1), được xây dựng từ trình tự gen 1D, các chủng FMDV được phân thành 10 kiểu gen chính(đánh số thự tự theo thời gian phân lập) 13    Hình 1: Cây UPGMA xây dựng từ trình tự gen 1D, biểu thị mối quan hệ di truyền của các chủng FMDV serotype A. Genotype (kiểu gen) được đánh dấu từ I-X ( theo thứ tự thời gian phân lập) được hiển thị trong các nhánh 14    4.2.Các Genotype trong cây sinh dòng 4.2.1.Genotype I Kiểu gen này đại diện cho 16 chủng được phân lập trong khoảng 5 thập kỉ (19421986), bao gồm các virus từ Columbia,Greece, India, Italy,Morocco,Netherlands và Spain. Trong nghiên cứu này, chúng tôi lưu ý đến những kiểu gen lâu đời nhất của FMDV serotype A. 4 chủng được phân lập bao gồm cả A10-IVS được đưa vào nhóm này. Độ biến động giữa 2 chủng A10-IVS và A10-Holland là khoảng 1,3%. Những bằng chứng này cho thấy 3 chủng phân lập thì có mối quan hệ gần với A10-IVS( độ biến động 1.8-2.2%) để chỉ ra rằng có sự biến đổi chủng virus từ các chủng vacxin là có thể xảy ra.. Những virus thuộc genotype này được phân lập ở Ấn Độ từ 1984-1986 và không tìm thấy chúng nữa sau năm 1986. Armstrong và các cộng sự đã tường thuật mối quan hệ gần gũi cuộc các dòng virus Ấn Độ trong quá trình phục hồi suốt năm 1986 với A10Holland/42 bằng việc sử dụng kháng thể đơn dòng 4.2.2.Genotype II Kiểu gen II có chứa nhugn74 chủng từ Argentina, Brazil, United Kingdom Venezuela được phân lập trong thời gian 1954-1979 và 4.2.3.Genotype III Kiểu gen này đại diện cho bốn chủng trên lợn được phục hồi từ Trung Quốc suốt thời gian 1958-1964. Sự biến động giữa chúng từ 2,4-9,5%. Kiểu gen này đại diện cho những chủng được phân lập từ vùng mà được báo cáo là có virus type O 4.2.4.Genotype IV Các chủng từ Bangladesh, India, Iraq và USSR được phân lập từ 1964-1989 được gộp lại trong genotype này chỉ sự phổ biến và sự lan trải trên một vùng địa lý rộng lớn . Chủng A22 Irag 24/64, được phân lập năm 1964, là chủng lâu đời nhất được phân lập trong nhóm này với sự biến động 15,1-16,4% với những chủng Indian trong cùng genotype. Điều quan trọng cần lưu ý là các chủng này được phân lập trước năm 1990 và dường như không còn tồn tại ở Ấn Độ. 4.2.5.Genotype V Những chủng thuộc kểu gen này đến từ Châu Âu (Spain/73) và Nam Mỹ (Argentina/87) và được phân lập trong suốt 15 năm 4.2.6.Genotype VI Kiểu gen này gồm 25 chủng được phân lập bao gồm 1 chủng vacxin IND 490/97 được phân lập năm 1982 và hầu hết là từ gia súc, có hai chủng phân lập từ trâu và 1 chủng phân lập từ bò. Sự biến động giữa các chủng trong nhóm khoảng từ 0,2-12,8 % . Chủng vacxin IND 490/97 được ước tính với sự biến động 6,8-12,1% nu so với những chủng còn lại trong nhóm này. 15    4.2.7.Genotype VII Kiểu gen VII chứa 49 chủng bao gồm một chủng phân lập từ Albania (Albania/96), tỷ lệ biến động 2.8-14,7% so với những chủng phân lập ở Ấn Độ.Hầu hết những chủng được phân lập trên gia súc và 2 chủng được phân lập trên trâu (IND 39/2000 và IND 81/2000). IND 21/90 phân lập vào năm 1989 từ Assam là chủng lâu đời nhất trong genotype này 4.2.8.Genotype VIII Các virus thuộc kiểu gen này được tìm thấy ở Iran, SaudiArabia, và Thổ Nhĩ Kì. Hai chủng được phân lập gần đây cho thấy tỷ lệ biến động xấp xỉ 1,8% trái lại Iran/87 là chủng được phân lập lâu nhất trong nhóm này cho thấy tỷ lệ biến động tối đa 8,8-12,4 % so với những chủng còn lại trong nhóm này 4.2.9.Genotype IX Kiểu gen này bao gồm 1 chủng từ Malaysia và 2 chủng có quan hệ gần nhau ( độ tin cậy 96,7%) được phân lập từ năm 1993 đấn 1997. Sự khác biệt giửa các nu có thể thấy trong nhóm 4.2.10.Genotype X Kiểu gen này chỉ tìm thấy ở Iran, bao gồm 3 chủng được phân lập trong thời gian 2 năm (1997 và 1998). Tỷ lệ biến động tối đa khoảng 1,8% được so sánh giữa Iran/4/98 và Iran/17/97. Chúng biến động gần 19% so với những chủng phân lập khác cũng ở Iran trong Genotype VIII. Kiểu gen này chia một nhánh với kiểu gen VII, cho thấy sự hiện diện của cùng một tổ tiên chung giữa 2 kiểu gen này. 4.3. PHÂN TÍCH SỰ PHÁT SINH LOÀI TRÊN GEN 1D Để phân tích mối quan hệ tiến hóa giữa những chủng FMDV phân lập được, một cây quan hệ đã được xây dựng dựa trên trình tự gen 1D (hình 2). Trong cây này, những dòng Châu Âu và Nam Mỹ ( bao gồm dòng Indian A10) tạo thành một cụm so với các dòng Châu Á. Đây là một điều thú vị , hầu hết các chủng trong mỗi cụm thì được chia thành các dòng khác nhau theo kiểu tương tự như trong cây UPGMA, và được phân về địa lý. Mặc dù các chủng được phân lập trong kiểu gen IV hình thành một nhóm phân biệt trong cây UPGMA. Chúng không tạo thành một cụm đơn trong cây quan hệ và được rải rác hầu hết ở các chủng khác trong cây quan hệ. Ý nghĩa của mỗi dòng được hỗ trợ bởi giá trị bootstrap trên 50% (trong số 100 bản sao). Các cụm Châu Âu và Nam Mỹ được chia thành 3 dòng với tỷ lệ bootstrap tin cậy khoảng 54-69%. Trong cụm Châu Á, những virus được phân lập gần đây từ Ấn Độ hình thành 2 dòng riêng biệt (kiểu gen VII và VII) với giá trị bootstrap khoảng 57-99% và có vị trí xa nhau trong cây quan hệ. Trong cây quan hệ, chủng Ấn Độ IND 2/93, được nhóm chung với kiểu gen Iran (kiểu gen X).Mặc dù việc hình thành nhóm được chứng minh bởi giá trị bootstrap thấp (31%) nhưng cũng không thể loại trừ khả năng IND 2/93 có thể là tổ tiên của dòng Iran. Điều này là có thể khi so sánh những trình tự amino acid của nhóm này với dòng Ấn Độ. 16    Những kiểu gen châu Á còn lại( III, VIII và IX) hình thành những dòng xác định trong cây với giá trị bootstrap trên 99% 4.4. SO SÁNH TRÌNH TỰ AMINO ACID CỦA VÙNG VP1 Để phân tích các cơ sở phân tử cho thấy sự biến động di truyền trong những chủng phân lập ở Ấn Độ, trình tự amino acid của gen 1D cũng được so sánh (hình 3). Một số tài liêu cho thấy rằng vị trí kháng nguyên trong FMDV serotype A tại vị trí vòng lặp G-H (từ 138 đến 154), và gần các vị trí 83,168 và 173 của protein VP1. Trong vòng lặp G-H, RGD tripeptide tại vị trí VP1 144-146 và 2 acid amim Leucine(L) tại vị trí 147 và 150 là được bảo toàn một cách đầy đủ trên các chủng đã được phân lập tại Ấn Độ . Tuy nhiên,sự thay thế thường xuyên các amino acid cũng được quan sát trên những vùng lân cận( VP1 139,140,141,142,149,153). Đây là khu vực quan trọng vì có thể tìm được miễn dịch trội của FMDV A22.. Vòng lặp B-C (VP1 40-60) chứa một vị trí kháng nguyên quan trọng của FMDV serotype O và C, trái lại không có báo cáo nào về kháng nguyên thuộc vùng này trên FMDV seotype A. Từ những báo cáo so sánh, vị trí VP1 42-48 thí quan trọng trong việc xác định kháng nguyên của những chủng virus có trình tự amino acid thay đổi một cách thường xuyên. Trong genotype VI và IV( ngoại trừ chủng được phân lập trên voi, IND 61/88), tất cả những chủng được phân lập có trình tự RRGD tại ví trí VP1 143146, trong khi hầu hết các chủng phân lập trong genotype VII (ngoại trừ IND 2/93, IND 96/96 và IND 104/2000),có TRGD tại cùng một vị trí. Một vị trí kháng nguyên nhỏ đã được xác định rõ đặc điểm tại VP1 169 (tương ứng với 168 ở FMDV A22) trên virus A10-Holland. Trong genotype IV và VI (ngoài trừ IND 170/88) hầu hết các chủng phân lập đều có Arginine(R) , trong khi đó ở genotype VII (ngoại trừ IND 21/90 và IND 2/93), Lysine (K) được tìm thấy tại vị trí VP1 168. Vị trí VP1 173 cũng có vai trò quan trọng trong việc xác định điểm kháng nguyên, và một số amino acid thay thế được tìm thấy trên những chủng được phân lập, Hai aminoacid thay thế tại VP1 109 (K→R) và 213 (L→Q) thì đặc trưng cho một chùng phân lập trên voi (IND 61/88) trong genotype IV. Có 24 loại amino acid khac nhau trong đó có 15 loại nằm gần hay ngay tại vùng kháng nguyên gữa 2 chủng vacxin được sử dụng gần đâylà IND 490/97 và IND 17/77. Việc thay thế các amino acid được xem xét trong vùng kháng nguyên của những chủng khác nhau được mong đợi là sẽ ảnh hưởng tới tính kháng nguyên của protein VP1. Trong genotype I, cả 3 chủng có mối quan hệ thân thuộc với chủng vacxin A10-IVS thì khác nhau tối đa 6 amino acid. Trong tất cả các chủng đã phân lập, bao gồm A10-IVS thiếu mất 1 codon tại vị trí VP1 142 khi so sánh vói A10-Holland 17    Hình 2: Cây sinh dòng của FMDV serotype A suy ra bằng phương pháp neighbor-joining. Giá trị bootstrap tin cậy của những dòng chính đã được chỉ định (giá trị trên 50% trong số 100 bản sao). Những kí hiệu genotype ,được xác định trong cây UPGMA (hình 1) đã được chỉ định. Chiều dài của nhánh đã giảm đến 50% để tiết kiệm không gian. Tỷ lệ của các thanh đại diện cho khoảng cách di truyền 18    PHẦN V : KẾT LUẬN 5.1.KẾT LUẬN Ở đây chúng tôi chỉ tiến hành phân tích di truyền hoàn toàn trình tự vùng trình tự vùng 1D(639 nu) của 82 chủng FMDV serotype A được phân lập , bao gồm 3 chủng vaccine (A10-IVS, IND 17/77 và IND 490/97) được khôi phục ở Ấn Độ trong thời gian 1977- 2000. Để nghiên cứu những biến đổi phân tử có liên quan đến đa dạng di truyền trên một số chủng phân lập, chúng tôi đã giải trình tự và so sánh hoàn toàn gen 1D và suy ra trình tự amino acid. Tiến hành xây dựng cây sinh dòng của 82 chủng virus serotype A. Những báo cáo so sánh đã chỉ ra rằng những thay thế tại các vị trí 83, 139, 140, 141,149,153 và 173 trên VP1 và những phần còn lại được xác định là quan trọng bởi những đột biến trung hòa của FMDV serotype A.Những kết quả được miêu tả trong bài báo cáo này chỉ ra sự liên quan của vòng lặp B-C VP1 trên các kháng nguyên của FMDV serotype A. Từ những vùng này phần quan trọng của kháng nguyên, những thay thế tại những vị trí này trên protein VP1 được tin rằng có vai trò giúp đỡ virus thoát khỏi những miễn dịch xuất hiện lúc đầu trên thú Những chủng FMDV serotype A từ các phần khác nhau trên trên thế giới có thể được chia ra làm thành 10 genotype phân biệt trong cây UPGMA, mỗi nhánh đại diện cho một vùng địa lí. Những genotype này,ngoại trừ genotype IV, hình thành từ những nhánh khác nhau trong cây quan hệ với độ tin cậy bootstrap cao. Các chủng trong genotype IV thì trộn lẫn với genotype khác trong cây. 5.2.ĐỀ NGHỊ Tiếp tục tiến hành phân tích các chủng FMDV serotype A , xây dựng cây sinh dòng của các chủng FMDV serotype A được phân lập từ năm 2000 đến nay. Tiến hành phân tích xây dựng cây sinh dòng FMDV các serotype còn lại, đặc biệt là FMDV serotype O và Asia-1 là những serotype phổ biến ở Việt Nam 19   
- Xem thêm -