Vaccine phòng bệnh do pasteurella

  • Số trang: 23 |
  • Loại file: PDF |
  • Lượt xem: 21 |
  • Lượt tải: 0
nganguyen

Đã đăng 34173 tài liệu

Mô tả:

VACCINE PHÒNG BỆNH DO PASTEURELLA BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐH NÔNG LÂM BỘ MÔN CNSH GVHD: PGS.TS.Nguyễn Ngọc Hải CỘNG HÒA XÃ HỘI CHỦ NGHĨA VIỆT NAM ĐỘC LẬP – TỰ DO – HẠNH PHÚC IH Tiểu luận GVHD: PGS.Ts. Nguyễn Ngọc Hải SVTH: Phan Thị Anh Văn Lớp: DH06SH 1 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải I.KHÁI QUÁT VỀ VACCINE 1.LỊCH SỬ RA ĐỜI CỦA VACCINE Vaccine đầu tiên gắn với tên tuổi của Edward Jenner, một bác sĩ người Anh. Năm 1796, châu Âu đang có dịch đậu mùa, Jenner đã thực hiện thành công thử nghiệm vaccine ngừa căn bệnh này Thời điểm 1798, khi Jener công bố kết quả thí nghiệm của mình, người ta chỉ hình dung là có các "mầm bệnh" gây nên sự truyền nhiễm. Tám mươi năm sau, Louis Pasteur nghiên cứu bệnh tả khi dịch tả đang tàn sát đàn gà Pasteur đã xác nhận các giả thuyết của Jenner và mở đường cho khoa miễn dịch học hiện đại 2.ĐỊNH NGHĨA Vaccine là một chế phẩm sinh học chứa vật chất của mầm bệnh được gọi là "kháng nguyên".Khi đưa vào cơ thể người hoặc động vật sẽ kích thích cơ thể tạo ra một trạng thái miễn dịch, giúp cơ thể chống lại mầm gây bệnh Dù chế tạo bằng công nghệ nào đi nữa thì vaccine phải bảo đảm bốn tiêu chuẩn cơ bản sau: - Không gây phản ứng toàn thân.Có thể có phản ứng cục bộ, nhưng những biểu hiện lâm sàng phải biến mất 24 giờ sau khi tiêm phòng - Hiệu lực phòng bệnh cao và kéo dài - Tiêm nhẹ tay, liều tiêm thấp và bảo quản dễ dàng - Giá thành hạ 3.THÀNH PHẦN CHỦ YẾU CỦA VACCINE Có hai thành phần chủ yếu trong vaccine đó là:Kháng nguyên và chất bổ trợ vaccine. - Kháng nguyên:kháng nguyên được hiểu là một chất khi đưa vào cơ thể sẽ kích thích cơ thể vật chủ sản sinh kháng thể và tạora mộ lớp tế bào mẫn cảm đặc hiệu chống lại sự xâm nhập và gây bệnh của mầm bệnh - Chất bổ trợ vaccine: Là những chất được bổ sung vào vaccine, có khả năng kích thích sinh miễn dịch không đặc hiệu nhằm nâng cao hiệu lực và độ dài miễn dịch của vaccine Bổ trợ kết hợp với kháng nguyên làm tăng tính lạ của kháng nguyên khi vào cơ thể,nên đáp ứng miễn dịch mạnh hơn,quá trình tổng hợp protein cao hơn.Vaccine có bổ sung chất bổ trợ sẽ tạo được miển dịch mạnh hơn ,thời gian miễn dịch kéo dài hơn 4.PHÂN LOẠI VACCINE Dựa vào thành phần kháng nguyên có trong vaccine, hoặc căn cứ vào hoạt tính của mầm bệnh hoặc công nghệ chế tạo vaccine để phân loại vaccine 4.1 Dựa vào thành phần kháng nguyên vaccine thế hệ I – vaccine toàn khuẩn Vaccine toàn khuẩn có thể bao gồm kháng nguyên thân, vỏ bọc và độc tố của nấm bệnh sản sinh ra trong quá trình phát triển. Vaccine thế hệ II Trong vacxin chỉ chứa một số thành phần gây bệnh của mầm bệnh nguyên. . Vaccine thế hệ III-Vaccine tái tổ hợp Vaccine tái tổ hợp được sản xuất bằng nghệ gen ( genetic engeneering ) như vaccine tái tổ hợp phòng bệnh cúm gia cầm H5N1, vaccine tái tổ hợp LMLM v.v... 4.2. Dựa vào hoạt tính của mầm bệnh Trong nhóm này có hai loại vaccine: vaccine vô hoạt và vaccine nhược độc 2 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải a.Vaccine vô hoạt Vaccine vô hoạt là vaccine chứa mầm bệnh- kháng nguyên đã được vô hoạt bằng các yếu tố vật lý như: Nhiệt độ, tia tử ngoại, sóng siêu âm; bằng các hóa chất như: Các loại thuốc nhuộm,các axit, formol v.v... Vaccine vô hoạt không có bổ trợ Loại vaccine này còn được gọi là bacterin. Vaccine bacterin chỉ chứa một thành phần chủ yếu là kháng nguyên. Công nghệ chế tạo bacterin khá đơn giản phù hợp với các nước có trình độ chế tạo vaccine đơn giản, có giá thành hạ. Song hiệu lực vaccine này thấp, độ dài miễn dịch ngắn. Hiện nay loại vaccine này được sản xuất rất ít, thường sản xuất dạng vaccine chuồng cho một số cơ sở có yêu cầu. *Vaccine vô hoạt có bổ trợ vaccine Trong vaccine này ngoài kháng nguyên đã được vô hoạt còn có bổ trợ vaccine. Các bổ trợ vaccine hiện nay thường dùng là keo phèn, phèn chua và bổ trợ dầu khoáng. b. Vaccine nhược độc Vaccine nhược độc là vacine chứa mầm bệnh được làm nhược độc hoặc vô độc, nhưng vẫn bảo toàn tính khàng nguyên. I.2. CƠ CHẾ HOẠT ĐỘNG CỦA VACCINE Hệ miễn dịch nhận diện vắc-xin là vật lạ nên hủy diệt và "ghi nhớ" chúng. Về sau, khi tác nhân gây bệnh thực thụ xâm nhập cơ thể, hệ miễn dịch đã ở tư thế sẵn sàng để tấn công tác nhân gây bệnh nhanh chóng hơn và hữu hiệu hơn (bằng cách huy động nhiều thành phần của hệ miễn dịch, đặc biệt là đánh thức các tế bào lympho nhớ). Đây chính là các ưu điểm của đáp ứng miễn dịch đặc hiệu. I.3.PHƯƠNG PHÁP CHUNG SẢN XUẤT VACCINE Tạm hiểu đơn giản việc sản xuất theo cách: Cách sản xuất cổ điển: Lấy chính vi khuẩn gây bệnh, làm giảm độc lực (tạm gọi là kháng nguyên) tiêm vào người thì chúng không đủ sức gây bệnh mà kích thích cơ thể tạo ra chất miễn dịch (gọi là kháng thể). Lần sau gặp lại vi khuẩn, kháng thể chống lại nên cơ thể không mắc bệnh. Cách sản xuất hiện đại: Chỉ lấy một ít kháng nguyên ở vi khuẩn gây bệnh, “cấy” vào một vi khuẩn lành tính, làm cho nó sinh sôi nảy nở, rồi “chiết” kháng nguyên từ vi khuẩn lành tính đó ra làm vacxin. Cách điều chế bằng “công nghệ sinh học” này chỉ dùng một lượng kháng nguyên nhỏ, đỡ tốn kém, chỉ cần dùng một liều rất nhỏ 1 Sơ đồ sản xuất vaccine trên trứng Giống vi rút Tiêm cho trứng có phôi 10 ngày Thu nước trứng Sản xuất vaccine 3 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải 2 sơ đồ sản xuất vaccine trên môt trường tế bào Mô trường tế bào Nhiễm vi rút , đẻ tủ ấm Thu hoạch tế bào có vi rút Sản xuất vaccine I.4.ỨNG DỤNG CÔNG NGHỆ SINH HỌC ĐỘNG VẬT TRONG SẢN XUẤT VACCINE 1. DNA TÁI TỔ HỢP . ADN tái tổ hợp là phân tử ADN được tạo thành từ hai hay nhiều trình tự ADN của các loài sinh vật khác nhau. Trong kỹ thuật di truyền, ADN tái tổ hợp thường là được tạo thành từ việc gắn những đoạn ADN có nguồn gốc khác nhau vào trong vectơ tách dòng. Những vectơ tách dòng mang ADN tái tổ hợp này có thể biểu hiện thành các protein tái tổ hợp trong các sinh vật. DNA vaccine Còn gọi là vaccine DNA tái tổ hợp, đây là loại nucleic acid vaccine, dựa trên nguyên lý một gen mã hóa cho protein kháng nguyên đặc hiệu được tiêm vào vật chủ (tế bào động vật hoặc vi sinh vật) để sản xuất các kháng nguyên này và khởi động một phản ứng miễn dịch. Nhiều vaccine phòng virus hiện nay (sởi, bại liệt, dại…) đều được sản xuất từ nuôi cấy tế bào động vật mà không phải là tế bào vi sinh vật. Phân lập một hoặc nhiều gen từ tác nhân gây bệnh (pathogen), đưa các gen này vào trong vòng DNA của plasmid và đóng lại. Các vòng DNA sau đó được đưa vào trong các nhóm tế bào nhỏ, thường bằng cách tiêm vào tế bào cơ hoặc đẩy vào da nhờ súng bắn gen. Các gen được chọn lựa mã hóa cho các kháng nguyên, các chất có thể gây ra một đáp ứng miễn dịch, thường được sản xuất bởi tác nhân gây bệnh. 2. NUÔI CẤY TẾ BÀO ĐỘNG VẬT Tế bào động vật tách từ mô có thể được nuôi cấy trên các loại môi trường dinh dưỡng tổng hợp bên ngoài cơ thể, chúng sinh trưởng bằng cách tăng số lượng và kích thước tế bào. 4 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải Kỹ thuật nuôi cấy tế bào động vật có vú có thể được ứng dụng để sản xuất các hợp chất hóa sinh quan trọng dùng trong chẩn đoán như các hormone sinh trưởng của người, interferon, hoạt tố plasminogen mô, các viral vaccine và các kháng thể đơn dòng Một số loại vaccine mới đang nghiên cứu Sử dụng các phụ gia (adjuvant) mới, nhằm gây ra loại đáp ứng miễn dịch mong muốn. Thí dụ, chất nhôm phosphate và các oligonucleotide chứa CpG demethyl hóa đưa vào vaccine khiến đáp ứng miễn dịch phát triển theo hướng dịch thể (tạo kháng thể) thay vì tế bào. Vaccine khảm: sử dụng một sinh thể quen biết để hạn chế hiện tượng "phản tác dụng", thí dụ dùng virus vaccinia mang một số yếu tố của virus viêm gan B hay virus dại. Vaccine polypeptidique: tăng cường tính sinh miễn dịch nhờ liên kết tốt hơn với các phân tử MHC: peptide nhân tạo 1/2 giống virus, 1/2 kia gắn MHC; đoạn peptide mô phỏng 1 quyết định kháng nguyên (epitope). Anti-idiotype: idiotype là cấu trúc không gian của kháng thể tại vị trí gắn kháng nguyên, đặc hiệu với kháng nguyên tương ứng. Anti-idiotype là các kháng thể đặc hiệu đối với idiotype, do đó anti-idiotype xét về mặt đặc hiệu lại tương tự với kháng nguyên. Vậy, thay vì dùng kháng nguyên X làm vaccine, người ta dùng idiotype anti-anti-X. II. VACCINE PHÒNG BỆNH DO VI KHUẨN PASTEURELLA II.1. PASTEURELLA 1. Một số bệnh do pasteurella Pasteurella là giống vi khuẩn gồm nhiều loài khác nhau, mỗi loài thích nghi gây bệnh ở một loại động vật khác nhau , nhưng chúng điều gây ra chứng bại huyết,xuất huyết nên người ta gọi bệnh này ở các loài gia súc gia cầm bằng một tên chung là bệnh tụ huyết trùng( pasteurellosis) Bệnh tụ huyết trùng trâu bò (pasteurelcosis bovum) là một bệnh truyền nhiễm cấp tính ở trâu, bò gây ra do pasteurella boviseptica(ở bò) và pasteurlla bulaiseptica(ở trâu) với các kiểu đặt trưng: tụ huyết và xuất huyết ở các vùng đặt trưng trên cơ thể, vi khuẩn thường xam nhập vào máu gây bại huyết. Bệnh tụ huyết trùng ở lợn (pasteurella sunum) là một bệnh truyền nhiễm cấp tính xảy ra ở lợn, thường phát sinh rải rát,có khi thành dịch địa phương. Bẹnh do vi khuẩn pasteurella suiseptica gây ra, đặc điểm của bệnh là viêm phổi ,viêm màng phổi, màng tim và bại huyết. Ở gia cầm, bệnh tụ huyết trùng do pasteurella aviseptica gây ra với đặc điểm gà ,vịt , ngang, ngỗng thường chết nhanh khi nhiễm bệnh như nhiễm đọc cấp tính với tỉ lệ chết rất cao. Bệnh tích thường gặp là viêm bao tim tích nước, mỡ vành tim xuất huyết, gan sưng tụ máu và có nhiều điểm tụ nước màu vàng. Ngoài ra pasteurella còn gây bệnh trên thỏ, chim và cả cá. Phương thức truyền lây của vi khẩn này là từ con bệnh trực tiếp qua con khỏe hoặc gián tiếp qua các nhân tố trung gian bị ô nhiễm vi khuẩn cường độc. Lây qua chất thải của gia súc gia cầm hay việc giết mổ bừa bãi Nhiều khi bệnh tự phát trong đàn gia súc gia càm vì vi khuẩn thường kí sinh trong cơ thể gia cầm, gia súc khỏe,bình thường¸giũa cơ thể gia súc gia cầm và vi khuẩn có sự cân bằng 5 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải sinh học. nhưng khi có sự mát cân bằng do ảnh hưởng ngoại cảnh oặc biến đổi gì đó trong cơ thể vi khuấn sẽ tăng cường độc và gây bệnh. Bệnh thường bùng phát rất nhanh và gây thiệt haị rất nặng nề. vì vậy conng tác phòng bệnh hết sức cần thiết và cấp bách. 2. Đặc điểm Vi khuẩn hình gậy ngắn tròn ở hai đầu ( một cầu trực khuẩn nhỏ có hình trứng hoặc bầu dục), kích thướt 0.25-0.4x0.41.5µm, vi khuẩn không có lông, không di động, không hình thành nha bào, bắt màu gram âm. Trong cơ thể bệnh vi khuẩn hình thành giáp mô nhưng khó quan sát và khi nhuộm, vi khuẩn có hiện tượng bắt màu xám hơn ở hai đầu tế bào nên người ta gọi Pasteurella là vi khuẩn lưỡng cực (Nguyễn Bá Hiên, 2008). Mọc được trong môi trường thạch thường và nước thịt thường. Nhiệt độ tối ưu 36-380C với pH=7.2-7.4 . Tùy nghi hiếu khí. Trên thạch mọc thành 3 loại khuẩn lạc S (láng): độc lực cao, M (nhày): độc lực yếu hơn, R (xù xì): độc lực yếu hoặc không độc lực. tính biến dạng rất lớn: khi cấy chuyển qua môi trường dinh dưỡng nhiều lần hoặc tiêm qua động vật thì dạng S có thể chuyển thành dạng M hoặc R và ngược lại. Đặc điểm quan trọng của Pasteurella Multocida là đặc tính dung quang của khuẩn lạc khi chiếu ánh sang xuyên 450nm. Đặc điểm này lần đầu tiên do Deruit (1921) phát hiện. Khuẩn lạc dạng S trên môi trường thường có tính dung quan, khuẩn lạc dạng M và R không có đặc tính nói trên. Theo Smith, đặc tính này có quan hệ chặt chẽ với sự tạo vỏ của chủng tụ huyết trùng. Dựa vào đặc tính này có thể chọn được những chủng tụ huyết trùng có tính kháng nguyên và miễn dịch cao. Vi khuẩn tụ huyết trùng dễ bị tiêu diệt bởi sức nóng, ánh sang mặt trời và chất sát trùng. Vi khuẩn bị diệt khi đun 580C trong 20 phút; 800C sau 10 phút; 1000C chết ngay Ánh sang mặt trời chiếu trực tiếp, diệt vi khuẩn trong canh trùng sau một ngày. Trong tổ chức của động vật bị thối nát, vi khuẩn sống được từ 1-3 tháng, các chất sát trùng thường diệt khuẩn nhanh chóng: axit phenic 5%, crezil 3%, nước vôi 1%, formol 2%... Vi khuẩn sống lâu và sinh sản trong đất ẩm thiếu ánh sang chúa nhiều muối nitrat và chất hữu cơ. Trong chuồng nuôi súc vật và trên đồng cỏ vi khuẩn sống hang tháng có khi hang năm. 3.Cấu trúc kháng nguyên Từ 1900 Ligninere bắt đầu nghiên cứu cấu trúc kháng nguyên của Pasteurella. Năm 1947 bằng thí nghiệm bảo hộ trên chuột Robert đã phân lập được 4 type P Multocida và kí hiệu là I, II, III, IV. Năm 1952, Carter đã phát hiện kháng nguyên vỏ đặc hiệu ở những biến chủng dạng S dựa trên phản ứng kết tủa đã phân loại vi trùng này thành 4 type và kí hiệu là A, B, C, D. Về sau, việc phân lập loại này đều dựa trên phản ứng ngưng kết hồng cầu gián tiếp. Carter phát hiện thêm type E và loại ra type C. Nhiều thí nghiệm đã chứng minh được mối quan hệ giữa hai cách phân type của Robert và Carter như sau 6 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải Theo Carter A B D E Theo Robert II, III, IV I 3.1. Kháng nguyên Có hai loại kháng nguyên là kháng nguyên K và O. Kháng nguyên K chỉ có ở vi khuẩn tạo dạng khuẩn lạc S không có ở dạng M và R. kháng nguyên K nhận được bằng cách cho canh trùng mới nuôi cấy vào nước sinh lý và chiết xuất trong vòng 30 phút ở 580C. Kháng nguyên K có hai thành phần α và β, chúng được cấu tạo từ protein và polysacharid. Các kháng nguyên khác nữa là kháng nguyên thân kí hiệu là kháng nguyên O. Có hai nhóm kháng nguyên O đặc hiệu và kháng nguyên O không đặc hiệu. Theo Carter, các chuẩn có serotype khác nhau sẽ khác nhau theo kháng nguyên O, chỉ có serotype P hầu như đồng nhất chỉ tồn tại một nhóm kháng nguyên O. Các khuẩn lạc chuyển từ dạng láng sang xù xì vẫn giữ nguyên kháng nguyên O. 3.2. Độc tố Một trong những tính chất quan trọng của P. Multocida là tạo nên quá trình bệnh lý là khả năng tạo độc lực của vi khuẩn này. Những độc tố này là loại độc tố mà cấu trúc hóa học giống kháng nguyên O và chính nó là hợp chất Lipo-polysacharid có trọng lượng phân tử cao chứa Nito và Photphat. Lipo-polysacharid của Pasteurella đều độc với thỏ, bê, chuột, gà. Chúng có tính gây viêm sốt và tạo miễn dịch chống vi trùng ở nhiều mức độ khác nhau. Gần đây, nhiều công trình đã xác định rằng Pasteurella sản sinh ra một loài độc tố khác, độc tố này là một loại protein có hằng số sa lắng là 2.99x103 (trong đệm photphat pH=7 và M-0.6). Việc tạo độc tố được coi như là một trong những yếu tố đánh giá độc tính của vi khuẩn này. Cần chú ý rằng những chuẩn tụ huyết trùng tạo độc tố cũng thường là nguyên nhân sinh bệnh viêm teo mũi truyền nhiễm ở lợn. Nhiều thực nghiệm đã chứng minh rằng dùng độc tố này của Pasteurella để chế vacxin phòng chống bệnh viêm teo mũi truyền nhiễm ở lợn có hiệu quả. 3.3 Tính bám dính vào mô bào Gần đây, nhiều nhà nghiên cứu chú ý đến sự khu trú và bám dính vào mô bào của Pasteurella và coi như một chỉ tiêu quan trọng để giải thích quá trình sinh bệnh của vi khuẩn tạo huyết trùng. Theo Jacques (1987), phát hiện ra rằng các chủng của cả hai sero type A và D bám vào tế bào biểu bì của khí quản không được chắc chắn, tuy nhiên chủng tụ huyết trùng thuộc serotype A bám dính vào phần nhám tế bào biểu bì có lông nhung. Tác giả Pizoan và Trigo (1989) cũng phát hiện các chủng của cả hai serotype A và D đều bám dính thưa thớt nhưng thấy chủng serotype phần lớn lại bám dính vào tế bào không có lông rung. 4.Cấu trúc phân tử Do tầm quan trọng của Pasteurella trong bệnh học thú y, người ta đã giải trình tự gen của vi khuẩn và phân tích được 104 gen có liên quang đến khả năng lây bệnh gắn trên bộ gen của pasteurella multocida- chiếm 7% trong tổng số trình tự mã hóa của bộ gen. chúng ta cũng đã khám phá ra một vùng dài 2,4kb chứa hai yếu tố gây độc tiềm năng của Pm gồm: pfhB1(pasteurella filamentous identical B1) và pfhB2 dài lần lược là 7,845 và 11,757 bp và hầu như có trình tự giống nhau trừ một vùng bị xóa trong trung tâm của trình tự pfhB1. cả hai yếu tố pfhB1 và pfhB2 chứa một vùng trình tự tương đồng với filamentuos hemaglutinin (FhaB) của B pertussis (19-21). FhaB chi phối việc bám dình của B pertussis lên tế bao chủ và là thành phần chủ yếu của vaccine acellular sử dụng cho bảo vệ người 7 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải chống lai bệnh ho gà. Có rất nhiều ý kiến cho rằng pfhB1 và pfhB2 là thành phần gây độc chính của pasteurlla. Vì nó có các đặc điểm chính sau: -Thứ nhất đầu amino – terminal của pfhB1 và pfhB2 theo mô hình N(P/Q)NG(I/M). mô hình này liên quan đến tiến trình sau phiên mã và tín hiệu ngoại bào. -Thứ hai: vùng trung tâm chứa đựng rất nhiều protif cũng là đặt tính của hộ này. Sự hiện diện của những vùng bảo vệ giống với FhaB của B pertussis , cả hai pfhB1 và pfhB2 là thành phần bám của vi khuẩn lên tế bào chủ. -Thứ ba: đầu tận cùng cacboxy chứa những vùng với độ tương đồng cao(66% aminoacid giống nhau)tương tự như protein kháng huyết thanh p76 của Haemophilus somnus. Khả năng này giúp cho vi khuẩn tăng khả năng sống xót trong cơ thể vật chủ và như vậy tăng cường khả năng gây bệnh cho vật chủ. Figure 2 Circular representation of the genome of Pm, Pm70. The Pm genome and its coding regions with homologies, the tRNA and rRNA operons, and the overall G-C content are presented. The outer circle represents the scale in base pairs with the origin noted. The outer arrows represent the 57 tRNAs and the inner arrows represent the 6 complete rRNA operons (16S–23S–5S). The 2,014 potential coding sequences are represented by colors depicting homology to both Ec and Hi (green), Ec alone (purple), Hi alone (light blue), or to organisms other than Hi or Ec or unique to Pm (red). The G-C % of each coding sequence is represented in the interior circle by different shades of pink in increments of 5%: the lightest pink represents a G-C % of 25–30% whereas the darkest pink represents 45–50%. The figure was generated by using genescene software (DNAstarMadison, WI). II.2 VACCINE PHÒNG BỆNH Để phòng bệnh tụ huyết trùng, hiện nay có rất nhiều loại vaccine khác nhau bao gồm vaccine truyền thống và vaccine mới sản xuất từ việc ứng dụng kỹ thuật công nghệ sinh hoc. Sau đây chúng ta sẽ tìm hiểu một số loại vaccine này. 1. Vaccine truyền thống a.Vaccine tụ huyết trùng vô hoạt nhũ hóa và keo phèn Đây là loại vaccine mới có dạng nhũ tương là nước trong dầu(water in oil) nó được hiểu như sau: sau khi nhũ hóa pha nước và pha dầu gần như hòa tan vào nhau, tao nên cấu trúc gồm hạt dầu bao quanh hạt kháng nguyên>> chính đặc điểm này mà kháng nguyên tồn tại lâu trong cơ thể vì có lớp dầu bảo vệ tránh bị enzyme phân hủy, tránh bị đào thải nhanh ra ngoài cơ thể>> gây kích thích miễn dịch kéo dài 8 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải Gần đây một số đọc giả đã chứng minh chủng vaccine FgHC( lợn) và các chủng vaccine IR, P2O5(trâu,bò) đều thuộc serotype B. Từ nghiên cứu trên chủng P2O5 được chọn làm chủng vaccine nhũ hóa cho cả trâu bò lợn. Hiện nay ứng dụng công nghệ sinh học kháng nguyên tụ huyết trùng trong vaccine nói trên được chế trong nồi kên men sục khí độ đậm cuả vi khuẩn tăng 20 lần. Do đó liều tiêm và điều kiện giảm hang chục lần. Vật liệu kháng nguyên vỏ của vaccine trong loại này gồm vỏ polysaccharide và những vật liệu phân lập từ tế bào bởi nhiều phương pháp khác nhau như giết chết vi khuẩn trong sản xuất vaccine và hệ thống miễn dịch, phân tách bằng dung dịch saline.Tốt nhất là, tuy nhiên, vật liệu kháng nguyên vỏ bao gồm protein và đặc biệt là lipopolysaccharide hơn nữa là polysaccharide. Nó thì chắc chắn rằng việc thêm protein và lipopolysaccharide thành phần tế bào trong phân tách capsure làm tăng tính kháng nguyên và khả năng miễn dịch như so sánh với phân tách capsure chứa đựng chủ yếu chỉ là polysaccharide. Phân tách thành phần vỏ của vi khuẩn theo nhiều cách thích hợp khác nhau như sử dụng dung dịch thiocyanate, Cetavlon hoặc Cetrimide. Protein và lipopolysaccharide sử dụng trong vaccine thì được xử lý với salicylate eg aqueous sodium salicylate Trong việc chủng bị vaccine thích hợp cho cơ thể được phát triển hoặc được duy trì, nguyên liệu kháng nguyên tương ứng đạt được từ cơ thể và được đưa vào vaccine. Kháng nguyên vỏ được đưa vào cơ thể bằng nhiều kỹ thuật thích hợp. Chủng bị một số vaccine :1 nhiệt sinh vật chết toàn bộ (HKO) trong một gel nhôm hydroxit(Alhydrogel)/nhũ hóa dầu(AO);2 vỏ được phân tách hoàn toàn trong chất bổ trợ của Freund;3 trích trong cùng một gel nhôm hydroxit (Alhydrogel)- nhũ hóa dầu(AO). Việc chuẩn bị của 3 vaccine như sau: Chuẩn bị vaccine - HKO trong AO Các sinh vật của P. haemolytica serotype A2, chủng FA2 được nuôi cấy, đánh dấu cho sự tinh khiết và tiêm chủng vào Oxiod No2, cả hai chủng được nuôi ở 370C trong 18h với sự đảo trộn. Tốc độ tăng trưởng là kết quả cho chủng vào 1.5 l Oxiod No2, sau đó ấp trong 6h trong điều kiện tương tự. Tốc độ tăng trưởng được tìm thấy trong một phạm vi 109 sinh vật trên mỗi ml, xác định bằng phương pháp EEL đo dộ đục. Vi khuẩn được thu hoạch bằng ly tâm ở 4oC trong 20 phút ở 12.000g. vi khuẩn này sau đó bị giết bởi xử lý nhiệt ở 60oC trong 16 phút. Nồng đọ tối ưu cho nhiệt giết vi sinh vật cho hấp phụ vào gel nhôm Hydroxit(Alhydrogel, Miles phòng thí nghiệm, Slough, Anh) được xác định bởi chủng độ theo hướng dẫn của nhà sản xuất(Miles phòng thí nghiệm, Slough, Anh). Các kháng nguyên này sau đó được hút bám vào hydroxit nhôm và kết quả thể vẫn được chuyển thành dạng trong một khối lượng bằng nhau Bayol F(Esso Petroleum, NJ, USA) chứa 10% Aracel A (Sigma Chemical Co., St. Louis, Mo., USA) - Viên nang chiếc xuất trong AO Serotype A2, chủng FA2, các vi sinh vật được nuôi và thu hoạch như việc chủng bị cuả HKO trong AO mô tả ở trên. Tuy nhiên, sau khi thu hoạch, các vi khuản lắng xuống thì được tạo thành dịch huyền phù trong 0,1 natri salicylate trong nước cất đến 1/10 khối lượng ban đầu. sau đó , nuôi có khoáy trộn ở 37oC trong 3h và ly tâm ở 2800g ở 4oC trong 40 phút. Phần nổi trên mặt, trong ống thẩm tách, thì được thẩm tách sau đó, chống lại 3 thay đổi của dung dịch buffered phosphat saline (pH 7,2) ở 4 ° C. Qua một khoảng thời gian 48h và tập trung vào bình ở 37oC. Các hoạt động tập trung kháng nguyên có thể được xác định 9 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải bởi sự thử nghiệm haemagglutination gián tiếp chống lại một kháng huyết thanh thỏ tiêu chuẩn cho trường hợp tương đòng serotype cua P. haemolytica. Các viên nang có thể được lưu trử và cất giữ ở -20oC. Đối với vaccine HKO nồng đọ tối ưu của kháng nguyên vỏ được xác định bởi chuẩn độ, các thành phần trích của vỏ hút bám trên Alhydrogel và cố định các kết quả thành dạng sữa với một khối lượng bằng nhau Bayyol chứa Aracel cung cấp capsure A2 trong AO vaccine. - Viên nang chiết xuất trong CFA Viên nang chiếc xuất các loại A2, chủng FA2, các vi sinh vật của P. haemolytica được chuẩn bị như mô tả ở trên. Trích lọc nồng độ của capsure A2, ở nồng độ tương tự như trong viên nang chiếc xuất tại AO vaccine, sau đó kết hợp bởi homogenization trong nước cất vào CFA(một phần là chất trích vỏ và một phần là chất bổ trợ) b. Vaccine nhược độc Pasteurella là một vi khuẩn có nhiều biến đổi, không ổn định, chúng có thể chuyển từ dạng không độc thành dạng độc và ngược lại. do vậy việc dùng vaccine nhược độc có rất nhiều rủi ro, có thể là đem gieo rắc mầm bệnh, làm cho việc phòng chống bệnh càng trở nên phức tạp. Rất khó tạo vùng an toàn sau khi sử dụng vaccine nhược độc. Vaccine nhược độc chỉ được sử dụng trong tình trạng cấp bách như tiêm vào ổ dịch đã xuất hiện. 2. Những hướng mới trong sản xuất vaccine Bệnh do loài Pasteurella là nguyên nhân gây thiệt hại kinh tế quan trọng trên toàn thế giới. Những vi khuẩn này hoạt động như thứ cấp và sơ cấp mầm bệnh và gây ra một phổ rộng các dịch bệnh, gọi chung là pasteurellosis và từ nhiễm trùng huyết đến viêm phổi. Pasteurella multocida được công nhận là một mầm bệnh thú y quan trọng . Tên Serotype được dựa trên capsular kết hợp kháng nguyên-kháng nguyên somatic (capsular kháng nguyên A đến F và kháng nguyên soma 1-16). Một số serotypes của P. multocida gây nhiễm trùng huyết xuất huyết (HS), một bệnh gia súc và trâu với tỷ lệ tử vong cao và ảnh hưởng kinh tế có ý nghĩa tại Châu Á và Châu Phi. Tại Nam Á,chiếm ưu thế serotype B: 2 (36). HS là một pasteurellosis chính đặc trưng bởi ga nhiễm trùng huyết và là khác biệt từ pasteurelloses khác, trong đó P. multocida có thể chỉ có một vai trò phụ. Cái các yếu tố độc tính của P. multocida chịu trách nhiệm cho HS đã không được xác định, và các kháng nguyên chịu trách nhiệm về miễn dịch tự nhiên là chưa biết. Một số kiểm soát là đạt được với vaccine phèn-tủa hoặc vaccine nhũ hóa giết chết tế bào tiêm dưới da(sc), nhưng các vắc xin có bất lợi của cung cấp miễn dịch chỉ ngắn hạn-(7) và yêu cầu hàng năm quản lý cho hiệu quả (10). Vắc xin nhũ hóa dầu có những bất lợi nhất của độ nhớt cao, mà làm cho họ không được ưa chuộng trong những người dùng trường, mặc dù được cải thiện Đáng kể là hiệu ứng mạnh mẽ của các lưu trữ trên những tiềm năng của phèn các-tủa nhiễm trùng máu xuất huyết (APHS) Thuốc chủng ngừa được báo cáo.chủng ngừa APHS, các nhà khoa học thong qua các nhiễm trùng thánh thức của thỏ tiêm(pót 60 ngày kể từ ngày tiêm phòng),cho thấy hiệu lực 100% khi được lưu trử ở 4oC trong 30 ngày. Và hiệu lực giảm xuống 20% khi thời gian lưu trữ được mở roongjdeends 60 hoặc nhiều ngày. Ở 30oC, hiệu lực giảm 40, 40 và 60 tương ứng sau 30,60,90 ngày lưu trữ. Trong khi đó ở 37 o C , hiệu lực giảm 60, 60 à 100% sau 30,60 và 90 ngày kể từ ngày lưu trũ tương ứng. theo quan điểm này, vaccine nhũ hóa HS, vaccine được phát trienr bởi nuôi Pasteurella multocida trong môi trường gồm men, sucrose, trypticase và bicarbonate natri, thong khí liên tục ơ 37oC. Điều nầy đã đưa ra một số vi khuẩn tốt hơn nhiều(số tối đa 15x108/ml) hơn 10 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải vaccine APHS thường tiêm ( ttoois đa 6x108/ml). Các vaccine OAHS nhũ tương dầu vẫn ổn định ở nhiệt độ phòng trong một năm. Nhật ký bảo vệ các giá trị của hai loại vaccine OAHS, nghiên cứu ở chuột, đã được 5,2 và 5,3 so với 1.9 của vaccine APHS. Hiện nay, trong nước cũng như trên thế giới sử dụng vaccine vô hoạt nhũ hóa dầu để phòng bệnh về pasteurella. Tuy nhiên với sự phát triển của kỹ thuật công nghệ sinh học, các nhà nghiên cứu đang khảo nghiệm một số loại vaccine được sản xuất theo phương pháp mới. Sau đây là một số đề xuất. *** Nghiên cứu sử dụng gen Pasteurella lipoprotein E như một kháng nguyên trong vaccine. Họ tiến hành tái tổ hợp gen này vào E.coli. Ecoli tổng hợp protein do gen này qui định và được phân tách để làm vaccine. Trong một khía cạnh, phát minh hiện nay cung cấp một chủng ngừa tiểu đơn vị để bảo vệ động vật từ bệnh do P. multocida, được đặc trưng bởi bao gồm Pasteurella lipoprotein E (PlpE) như kháng nguyên, và một tá dược thú y chấp nhận được.Trong một cách hiểu nào đó pasteurella lipoprotein E là một protein có trình tự axid amin được liệt kê SEQ ID EF219452-EF219457 (SEQ ID No 1-6) hay axit amin với một trình tự tường đồng của hơn 90% các axit amin trình tự như được liệt kê trong SEQ ID EF219452-EF219457 (SEQ ID No 1-6). Trong một khía cạnh khác, phát minh hiện nay cung cấp một sử dụng E lipoprotein Pasteurella trong việc kiểm soát các bệnh lây nhiễm gây ra bởi P. multocida, hoặc các rối loạn liên quan đó. Tóm tắt nghiên cứu như sau: Gen mã hóa lipoprotein E ở P. multicoda(plpE) và lipoprotein B(plpB) được tạo dòng từ p. multicoda chủng X- 73 serotype A:1 và được biểu hiện vào E.coli. Miễn dịch bảo vệ nhận được bởi PlpE tái tổ hợp(rPlpE) và PlpB tái tổ hợp(rPlpB) có giá trị trên chuột và gà. Kết quả cho thấy, đáp ứng miễn dịch ở chuột với 10g rPlpE tinh khiết thì được bảo vệ(80100%)kháng lại yếu tố gây nhiễm với 10 hoặc 20 LD50 P. multicoda chủng X73 ( serotype A:1), P-1059(serotype A:3) và P-1662(serotype A:4). Trong nghiên cứu này không có đáp ứng miễn dịch ở chuột với rPlpB không được bảo vệ. ở gà, đáp ứng miễn dịch với 100g rplpE tinh khiết bảo vệ 63-100% kháng lại yếu tố gây nhiễm với chủng X-73 và P-1662. ngược lại với rplpB thì không. Phân tích trình tự cho thấy plpE khác nhau ở các chủng P.multicoda biểu hiện 90,8-100% tương đồng. Ví dụ: Chuẩn bị tái tổ hợp Lipoprotein E (r-PlpE) của P. multocida trong E. coli (1). Giống vi khuẩn và sự phân lập DNA bộ gen của P. multocida P. multocida chủng chuẩn X-73 (A:1), P-1059(ATCC 15742) (A:3), và P-1662 (A:4) được nuôi ở 37oC trong não tâm huyền (BHI) canh(Difco phòng thí nghiệm, MI, Hoa Kỳ) trong vòng 18-24h.DNA bộ gên thì được phân lập bằng sử dụng kit DNeasy tissue(Qiagen, Hilden, Germany) (2). tạo dòng gen và vector biểu hiện xây dựng lipoprotein E tái tổ hợp từ chủng P. multocida X-73. Các gen khuếch đại sau đó đã được sử dụng để thể hiện PlpE tái tổ hợp(rPlpE) trong E.coli. trình tự mồi P1/P2 như sau: P1: 5'-CCA TGG GCA TGA AAT TAA CAA AAC TTT T-3', and P2: 5' AAG CTT CCA ACC TTT AAC TAC ACC ACC-3'. P1: 5'-CCA TGG GCA TGA AAT TAA CAA AAC TTT T-3 ', và P2: 5' AAG CTT CCA ACC 11 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải TTT AAC TAC ACC ACC-3 '. những mồi chứa ezyme hạn chế (NcoI hoặc XhoI) cắt các vị trí của nó tại đàu kết thúc 5’( gạch chân dãy), tiếp theo trình tự cụ thể của plpE. Các sản phẩm PCR được nhân bản vào pET28a vector biểu hiện theo hướng dẫn của nhà sản xuất (Novagen, Inc Madison, Wis) đẻ thu được một plasmid như pX73-PlpE. Bản chất của sự chền vào pET28a được xá nhận qua sự phân tích chuỗi trình tự DNA.trình tự của amino rprotein PlpE được mô tả như trong SEQ ID 1. (3). Biểu hiện và tinh sạch lipoprotein tái tổ hợp(r-PlpE) Plasmid tái tổ hợp pX73-PlpE thu được trong phần (1) được chuyển vào E.coli chủng BL21(DE3) và protein tái tổ hợp được tinh chế bằng sắc ký niken(Chang PC, et al, 2002., Dịch cúm gà Tháng Mười Hai 46:570 -- 80). Nói tóm lại chủng E.coli BL21 chứa các plasmid tái tổ hợp được nuôi cấy trong môi trường LB ở 37oC cho đến khi hấp thu qua bước sóng 600nm đạt 0,6. Isopropylthio-.beta.-D-thiogalactose (IPTG) đã được nồng độ cuối cùng 0,4 mM tiếp tục nuôi cấy thêm 3h nữa. các tế bào được viên tròn bằng máy ly tâm 3000 vòng/phút trong 20 phút, và tạo huyền phù trong 2ml dung dịch đệm bắt buộc(20 mM Tris pH 7,9, 5 mM imidazol, 500 mM NaCl). Kết ủa được đồng nhất và ly tâm ở 12000 vòng /phút trong 40 phút. Phần nỗi trên mặt được thu thập và nộp vào một cột chứa 2,5 ml dung dịch của Novagen. Cột được rữa sạch bằng 25ml đệm và 15 ml giải đệm((20 mM Tris pH 7,9, 50 mM imidazol, 500 mM NaCl) đẻ loại bỏ các protein không cần thiết. protein bị bắt giữ sẽ được tách với 15ml dung dịch rữa giải đệm(20 mM Tris pH 7,9, 250 mM imidazol, 500 mM NaCl), chỉ có 3ml dung dịch tách đầu tiền được thu nhận. Protein quan tâm được xác định bằng cách sử dụng bộ kít "Protein Assay" (BIO-RAD, Hercules, California, Mỹ). Các sản phẩm biểu hiện độ tinh khiết của protein tái tổ hợp được quan sát bởi SDS-PAGE và western blotting, tương ứng. Western blotting phân tích sử dụng kháng thể chống Hexa-histidine đơn dòng. Kết quả cho thấy kháng thể đơn dòng phản ứng với r-PlpB và r-PlpE, hơn nữa, cả hai r-PlpB và r-PlpE tạo ra hai nhóm trên các blot. Nhóm có kích cỡ tương ứng với khối lượng phân tử của rPlpB hoặc r-PlpE(31,5 hoặc 38,7 KDA), trong khi các nhóm nhỏ có khối luong phân tử (29,3 hoặc 36,3 KDA). Kết quả cho thấy rằng một số đột biến r-PlpB và r-PlpE xảy ra ở E. coli. Hình. 1 Expression và. Lọc của r-PlpB và r PlpE-in E. coli. (A) Coomassie blue-stained SDS-PAGE protein tái tổ hợp từ chiết xuất dầu thô hoặc các mẫu tinh khiết. Lane M đại 12 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải diện cho đoàn thể đánh dấu các phân tử. Các làn đánh dấu kiểm soát có chứa chiết xuất dầu thô của E. coli chứa plasmid không tái tổ hợp. (B) immunoblot của gel được thăm dò nhân đôi với chống chuột-Hexa-histidine đơn dòng kháng thể. Các nhóm tương ứng với rPlpB, r- PlpE và sản phẩm chế biến của họ được chỉ định bởi mũi tên. Đánh giá về bảo hộ Tác dụng của r-PlpE Đơn vị nhỏ hơn vắc xin trong BALB / c Chuột Mẫu Ba thí nghiệm đã được tiến hành trong BALB / c chuột. Trong thí nghiệm 1 và 2, nhóm chuột 6-tuần tuổi đã được chích ngừa dưới da với 10 microgram của r tinh khiết-PlpB hoặc r-PlpE trong chất bổ trợ hydroxit nhôm (Sigma-Aldrich Co, MO, Mỹ), hoặc là một mình hoặc cùng với một bacterin gồm 1.25.times.10.sup.7 hoặc 2.5.times.10.sup.7 CFU của bất hoạt formalin-P. multocida X-73 (A: 1). Hai tuần sau khi tiêm chủng, con chuột đã được thử thách với tiêm dưới da của 10-20 LD.sub.50 chủng của X-73. Trong thử nghiệm 3, con chuột đã được chích ngừa như mô tả cho các thí nghiệm 1 và 2. Hai tuần sau khi tiêm chủng, con chuột đã được thử thách với tiêm dưới da của 10 LD.sub.50 của chủng P-1059 (A: 3) hoặc P-1662 (A: 4), hoặc T2A5 chủng (mà là một chủng thách thức được sử dụng trong thuốc kiểm tra tại Đài Loan). Mọi con chuột thách thức đã được quan sát trong 10 ngày và tỷ lệ sống còn của họ đã được ghi lại. Các kết quả được tóm tắt trong bảng 1. Để phân tích thống kê, tỷ lệ sống còn được so sánh bởi Chi-bình phương thử nghiệm bằng cách sử dụng phần mềm SAS (SAS Institute Inc, Cary, NC, Mỹ). Những lần có nghĩa là cho đến chết được so sánh bằng cách sử dụng các thủ tục GLM trong các phần mềm tương tự. Sự khác nhau được coi là đáng kể khi p <0,05. BẢNG 1 Kết quả xét nghiệm miễn dịch và thách thức trong BALB / con chuột c Challenge căng. With.sup.1 chích ngừa và% dose.sup.2 survival.sup.3 Exp. 1 X-73 (A: 1) Control 30 CFU 0 (0 / 6). Sup.a r-PlpB (10 microgram) 30 CFU 0 (0 / 10) sup.a r.-PlpE (10 microgram) 30 CFU 100 (10/10) sup.b bất hoạt X-. 73 (2,0. lần. 10.sup.8 CFU) 30 CFU 100 (6 / 6) sup.b bất hoạt X-73. (1,25. lần. 10.sup 0,7 CFU) 30 CFU 17 (1 / 6) sup.a không hoạt động. X-73 (1,25. lần. 10.sup.7 CFU) + 30 CFU 30 (3 / 10) sup.a r-PlpB. (10 microgram) bất hoạt X-73 (1,25. lần 10.sup.7 CFU). + 30 CFU 10 (10/10). sup.b r-PlpE (10 microgram) Exp. 2 X-73 (A: 1) Control 60 CFU 0 (0 / 6). Sup.a r-PlpB (10 microgram) 60 13 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải CFU 10 (1 / 10) sup.a r.-PlpE (10 microgram) 60 CFU 80 (8 / 10) X-sup.bc không hoạt động. 73 (2,5. lần. 10.sup.7 CFU) 60 CFU 50 (3 / 6) sup.ab bất hoạt X-73. (2,5. lần. 10.sup 0,7 CFU) + 60 CFU 40 (4 / 10). sup.ab r-PlpB (10 microgram) bất hoạt X-73 (2,5. lần 10.sup.7 CFU). + 60 CFU 90 (9 / 10). sup.c r-PlpE (10 microgram) Exp. 3 P-1059 (A: 3) Control 35 CFU 0 (0 / 5). Sup.a r-PlpE (10 microgram) 35 CFU 100 (10/10) sup.b P.-1662 (A: 4) Kiểm soát 30 CFU 0 (0 / 5). sup.a r-PlpE (10 microgram) 30 CFU 100 (10/10) sup.b T2A5. (A: 1) Control 3 CFU 0 (0 / 5). sup.a r-PlpE (10 microgram) 3 CFU 80 (8 / 10). sup.b sup.1Mice trong nhóm kiểm soát. không được chích ngừa. LD.sub.50 sup.2The của chủng. X-73 và P1662 ở chuột đã được <3 CFU, và đó của P-1059 là 3,5 CFU.. nhân vật sup.3Different thứ tự chữ cái chỉ ra sự khác biệt đáng kể (p <0,05) giữa các nhóm. Trong thí nghiệm 1, chuột miễn dịch với 10 microgram của r tinh khiết-PlpE đã hoàn toàn được bảo vệ (100% sự sống còn) (1 bàn, thử nghiệm 1). Ngược lại, chuột miễn dịch với 10 microgram của r -PlpB tinh khiết đã không bảo vệ (0% sống sót) chống nhiễm trùng, thách thức với 30 CFU (> 10 LD.sub.50) của X-73 (serotype A: 1). Chuột chích ngừa với một bacterin gồm 2.lần.10.sup.8 CFU của bất hoạt formalin-X-73 đã hoàn toàn được bảo vệ (100% sự sống còn), trong khi những chuột chích ngừa với một bacterin gồm một liều thấp hơn (1.25.times.10 sup.7 CFU). của X-73 đã không bảo vệ (17% sống còn) (1 bàn, thử nghiệm 1). Để điều tra xem r-PlpB hoặc r-PlpE có thể nâng cao hiệu quả bảo vệ của các bacterin, con chuột đã được chích ngừa với một bacterin gồm 1.25.times.10.sup.7 CFU của X-73, bổ sung với r microgram 10-PlpB hoặc r -PlpE. Các kết quả cho thấy, r-PlpB không đáng kể nâng cao hiệu quả bảo vệ của các bacterin (sự sống còn 30%, p> 0,05) trong khi rPlpE đã làm (100% sự sống còn, p <0,05) (1 bàn, thử nghiệm 1). Trong thí nghiệm 2, liều thách thức của X-73 được tăng lên tới 60 CFU (> 20 LD.sub.50) và một bacterin gồm 2.5.times.10.sup.7 CFU của X-73 đã được sử dụng. Kết quả cho thấy rằng con chuột miễn dịch với 10 microgram của r-PlpB đã không bảo vệ (10% sống còn) trong khi những người có 10 microgram của r-PlpE đã được bảo vệ một cách đáng kể (80% sống sót, p <0,05) (1 bàn, thử nghiệm 2). Chuột chích ngừa với một bacterin gồm 2.5.times.10.sup.7 CFU của X-73 vừa được bảo vệ (50% sống còn). Chuột chích ngừa với bacterin, bổ sung cùng với r-PlpB cho thấy tỷ lệ sống của 40%, được tương tự như với 14 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải bacterin một mình. Ngược lại, chuột miễn dịch với bacterin, bổ sung với r-PlpE cho thấy tỷ lệ sống của 90%, được đáng kể so với với một mình bacterin (p <0,05) (1 bàn, thử nghiệm 2). Trong thí nghiệm 3, chủng P-1059 (serotype A: 3) và P-1662 (serotype A: 4) đã được sử dụng như là các chủng thách thức. Kết quả cho thấy rằng con chuột miễn dịch với 10 microgram của r-PlpE đã hoàn toàn được bảo vệ chống nhiễm trùng, thách thức với 10 LD.sub.50 của P-1059 hoặc> 10 LD.sub.50 của P-1662 (1 bàn, thử nghiệm 3). Kết quả này cho thấy, r-PlpE, được bắt nguồn từ X-73 (serotype A: 1), trao bảo vệ chéo trên con chuột chống lại thách thức với chủng serotypes A: 3 và A: 4. Ngoài ra, chuột miễn dịch với 10 microgram của r-PlpE cho thấy tỷ lệ sống của 90% khi thách thức với chủng T2A5 (A: 1), được lên đến các tiêu chuẩn kiểm tra chứng minh (sự sống còn tỷ lệ 60%) (p <0,05) ( 1 bàn, thử nghiệm 3). Đánh giá về bảo hộ Tác dụng của r-PlpE Đơn vị nhỏ hơn vắc xin trong SPF Gà Mẫu Ba thí nghiệm ở gà SPF đã được tiến hành. Trong thí nghiệm 1, nhóm 3 tuần tuổi gà SPF đã được chích ngừa dưới da với 100 microgram của r -PlpB tinh khiết hoặc r PlpE- trong chất bổ trợ của Freund's (Sigma-Aldrich). Ba tuần sau khi tiêm chủng sơ cấp, một chủng ngừa tăng cường được tiến hành, và ba tuần sau khi tiêm chủng hổ trợ, con gà đã được thử thách với tiêm bắp 3.6.times.10.sup.3 CFU của X căng-73 hoặc 5.5.times.10.sup 0,8 CFU của P chủng-1662. Trong thí nghiệm 2 và 3, con gà đã được chích ngừa dưới da hai lần với 125 microgram một chiết xuất dầu thô của r-PlpE trong một adjuvant nhũ tương đôi với một 3-tuần khoảng giữa chích ngừa. Các chiết xuất dầu thô đã được chuẩn bị bởi các dịch đồng nhất của E. coli có thể hiện r-PlpE. Các adjuvant nhũ tương đôi chứa Marcol 52 dầu (63%), Arlacel A (7%), và Tween 80 (1,5%). Ba tuần sau khi tiêm chủng hổ trợ, con gà đã được thử thách bằng cách tiêm bắp 3.6.times.10.sup.3-CFU 3.6.times.10.sup.6 của X căng73 hoặc 5.5.times.10.sup.7-5,5 times.10.sup.9 CFU của P -1662.. Mọi con gà thách thức đã được theo dõi trong 10 ngày và tỷ lệ sống còn của các bị ghi lại. Các kết quả được tóm tắt trong Bảng 2. Để phân tích thống kê, tỷ lệ sống còn được so sánh bởi Chi-bình phương thử nghiệm bằng cách sử dụng phần mềm SAS (SAS Institute Inc, Cary, NC, Mỹ). Những lần có nghĩa là cho đến chết được so sánh bằng cách sử dụng các thủ tục GLM trong các phần 15 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải mềm tương tự. Sự khác nhau được coi là đáng kể khi p <0,05. Table 2 Kết quả xét nghiệm miễn dịch và thách thức trong gà SPF có ý nghĩa trong thời gian để chích ngừa với sup.1 và liều.. Sup.2% sống sót. Sup.3 cái chết (ngày). Sup.3 Exp. 1 X-73 (A: 1) Control 3.6. Lần. 10.sup.3 CFU 30 (3 / 10). Sup.a 3.3.sup.a tinh khiết r-PlpB (100 microgram) 3,6. Lần. 10.sup.3 CFU 50 (5 / 10) sup.a 4.2.sup.a tinh khiết. R-PlpE (100 microgram) 3,6. Lần. 10.sup.3 CFU 100 (10/10) sup.b NA-P. 1662 (A: 4) Kiểm soát 5.5. Lần. 10.sup.8 CFU 13 (1 / 8) sup.a 4.1.sup.a tinh khiết. R-PlpB (100 microgram) 5,5. Lần. 10.sup.8 CFU 13 (1 / 8) sup.a 5.4.sup.a tinh khiết. R-PlpE (100 microgram) 5,5. Lần. 10.sup.8 CFU 63 (5 / 8). Sup.b 5.7.sup.a Exp. 2 X-73 (A: 1) Control 3.6. Lần. 10.sup.3 CFU 25 (2 / 8) sup.a 2.7.sup.a. 3.6. Lần. 10.sup.4 CFU 0 (0 / 8) sup.a 1.9.sup.a. 3.6. Lần. 10.sup.5 CFU 0 (0 / 8) sup.a 2.0.sup.a thô trích r-PlpE 3.6.. Lần. 10.sup.3 CFU 100 (8 / 8) sup.b NA. (125 microgram) 3,6. Lần. 10.sup.4 CFU 75 (6 / 8) sup.b 7.0.sup.b 3.6.. Lần. 10.sup.5 CFU 75 (6 / 8) sup.b 5.0.sup.b 3.6.. Lần. 10.sup.6 CFU 88 (7 / 8). Sup.b 4.0.sup.b Exp. 3 P-1662 (A: 4) Kiểm soát 5.5. Lần. 10.sup.7 CFU 25 (2 / 8) sup.a 5.7.sup.a. 5.5. Lần. 10.sup.8 CFU 13 (1 / 8) sup.a 4.1.sup.a. 5.5. Lần. 10.sup.9 CFU 0 (0 / 8) sup.b 2.9.sup.a thô trích r-PlpE 5.5.. Lần. 10.sup.7 CFU 50 (4 / 8) sup.a 4.8.sup.a (125 microgram) 5,5.. Lần. 10.sup.8 CFU 50 (4 / 8) sup.a 4.8.sup.a. 5.5. Lần. Tiêm chủng 10.sup.9 CFU 50 (4 / 8) sup.a 5.3.sup.a.. Sup.1 được tiến hành hai lần với một khoảng 3 tuần. Gà ở nhóm không được tiêm chủng. Sup.2., 3 ký tự chữ cái khác nhau chỉ ra sự khác biệt đáng kể (p <0,05) giữa các nhóm chủng ngừa và kiểm soát thách thức với liều cùng của X-73 hoặc P-1662. Trong thí nghiệm 1, gà tiêm chủng hai lần với 100 microgram của r tinh khiết-PlpB cho thấy tỷ lệ sống của 50% so với thách thức với X-73, nhưng tỷ lệ sống không đáng kể so với nhóm kiểm soát (30% sống còn , p> 0,05). Ngược lại, gà chích ngừa hai lần với 100 microgram của r tinh khiết-PlpE cho thấy tỷ lệ sống của 100%, được đáng kể so với nhóm chứng (p <0,05) (Bảng 2 thử nghiệm 1.). Kết quả này cho thấy rằng r-PlpE nhưng không rPlpB trao bảo vệ trên gà. Một kết luận tương tự đã được đạt đến khi chủng P-1662 đã được sử dụng như là căng thách thức (2 bàn, thử nghiệm 1). 16 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải Trong thí nghiệm 2 và 3, một chiết xuất dầu thô của r-PlpB và r-PlpE thay vì một trong những tinh khiết, đã được sử dụng như là các kháng nguyên. Hơn nữa, một adjuvant nhũ tương đôi, thay vì Freund's adjuvant hoàn chỉnh, được sử dụng như là các phần tạo nhũ tương. Những sửa đổi đã được tiến hành để giảm chi phí và lao động cần thiết để chuẩn bị và hành chính của các kháng nguyên. Kết quả cho thấy rằng con gà chích ngừa hai lần với 125 microgram chiết xuất dầu thô của r-PlpE có tỷ lệ sống của 75-100% so với thách thức với 3.6.times.10.sup.3-3.6.times.10.sup.6 CFU của căng X-73. Các tỷ giá đã cao hơn đáng kể so với những người trong nhóm chứng (p <0,05) (2 bàn, thử nghiệm 2). Hơn nữa, thời gian có nghĩa là đến cái chết của con gà miễn dịch với r-PlpE được đáng kể dài hơn là của nhóm kiểm soát (p <0,05) (2 bàn, thử nghiệm 2). Trong thí nghiệm 3, P-1662 đã được sử dụng như là chủng thách thức. Kết quả cho thấy rằng con gà miễn dịch với 125 microgram chiết xuất dầu thô của r-PlpE có tỷ lệ sống của 50% so với thách thức với 5.5.times.10.sup.7-5.5.times.10.sup.9 CFU của P - 1662. Những tỷ giá không cao hơn đáng kể so với những người của nhóm kiểm soát (p> 0,05), trừ khi liều thách thức của P-1662 đã được 5.5.times.10.sup.9 (p <0,05) (2 bàn, thử nghiệm 3). Những lần có nghĩa là đến cái chết của con gà chích ngừa được không đáng kể dài hơn những người của nhóm kiểm soát (p> 0,05) (2 bàn, thử nghiệm 3). Như vậy PlpE là một kháng nguyên tốt cho vaccine bảo vệ thú kháng lại bệnh do P.muticoda ***Sản xuất vaccine bằng cách gây đột biến gen aroA Live attenuated vắc xin nói chung có lợi thế của một con đường tự nhiên của mục nhập vào máy chủ, cho phép nhắm mục tiêu của các yếu tố để gây ra miễn dịch một cách nhanh chóng để hệ thống miễn dịch xảy ra trong các nhiễm trùng tự nhiên. Gen aroA mã hóa 5enolpyruvylshikimate-3-phosphat (EPSP) synthase, đó là tham gia vào việc chuyển đổi của axit shikimic thành chorismic axit, một trung gian phổ biến trong sinh tổng hợp của các axít amin thơm. Đột biến trong gen tạo ra một aroA cho sự tăng trưởng phụ thuộc vào các hợp chất thơm mà không phải là sẵn có trong máy chủ, như con đường này không phải ở các tế bào động vật có vú . Điều này có nghĩa là đột biến aroA có khả năng duy nhất hạn chế nhân rộng trước khi chúng được xóa khỏi máy chủ này. Attenuated aroA đột biến của P. multocida serotype 1, mà nguyên nhân gây bệnh tả ở gà, đã được miêu tả (14, 15) và có được hiển thị để cung cấp bảo vệ chống lại thách thức ở gà. Tuy nhiên,một serotype chủng không tạp giao-bảo vệ chống lại thách thức với serotype B chủng (1, 2, 26). Các mục tiêu của công việc này đã được xây dựng đột biến được định 17 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải nghĩa trong các gen của aroA hai serotype B: 2 chủng, để thử nghiệm các giống trong một con chuột thí nghiệm mô hình để xác định mức độ của họ và của sự mong manh bảo vệ chúng, và để so sánh các dẫn xuất đột biến với giống bố mẹ cho lây lan và kiên trì trong tế bào chủ. Vi khuẩn, plasmid, và điều kiện tăng trưởng. Các chủng vi khuẩn và plasmid sử dụng được liệt kê trong bảng 1 Chủng P. multocida thường được trồng trong não tâm truyền (BHI) canh (Oxoid) trong Flasks chấn động tại 150 vòng / phút ở 37 ° C hoặc trên BHI agar có chứa 5% (vol/ vol)máu cừu (B & E phòng thí nghiệm, Bonnybridge, Vương quốc Anh) và 1,2 %(wt / vol) agar. Định nghĩa hóa học Pasteurella tối thiểu trung bình (PMM) (17) cũng được sử dụng, khi cần thiết, phương tiện này chứa một “hỗn hợp các chất thơm” bổ sung gồm Ltryptophan, L-tyrosine, và Lphenylalanine, mỗi lúc một nồng độ cuối cùng của 40 g/ ml-1 và 2,3-dihydrobenzoic axit và-hydroxybenzoic axit, mỗi lúc một nồng độ 10 g /ml-1. Escherichia coli chủng được trồng tại Luria canh trong Flasks chấn động tại 150 vòng / phút ở 37 ° C hoặc trên Luria agar có chứa 1% (wt / vol) agar. Đối với E. coli chủ chứa số sao chép plasmid thấp , như pAKA19 và pEG18.3, bổ sung canh Terrific với 1% (wt / vol) căn cứ nitơ men (Difco) đã được sử dụng để cải thiện sản lượng plasmid. Kháng sinh (Sigma) đã được sử dụng ở nồng độ sau: ampicillin, 50 g /ml-1; chloramphenicol, 30 g ml1; tetracyclin, 15 g ml-1; Kanamycin, 50 g ml-1; vàstreptomycin, 100 g ml-1. Chuẩn bị và thao tác của DNA. DNA nhiễm sắc thể đã được chuẩn bị bằng cách: phương pháp Ausubel et al. (3), và plasmid DNA được cô lập bằng cách sử dụng QIAprep kit (Qiagen) theo hướng dẫn của nhà sản xuất. PCRs được thực hiện với 25 - l phản ứng hỗn hợp có chứa 10 mM Tris-HCl (pH 8,4), 50 mM KCl, 3 mM MgCl2, mỗi triphosphate deoxynucleoside ở nồng độ 200 M,? 100 pmol của mỗi mồi, 10 của các mẫu DNA, và 1 U of Taq DNA polymerase (Life Technologies, Paisley, Vương quốc Anh) bằng cách sử dụng các chu kỳ của 35 94 ° C trong 1 phút, 55 ° C trong 1 phút, và 72 ° C trong 1 phút và mở rộng một bước cuối cùng lúc 72 ° C trong 6 phút. Sản phẩm PCR và các mảnh endonuclease hạn chế được cắt phân đoạn bằng điện di agarose gel, excised từ gel, và tinh khiết bằng cách sử dụng một GenElute agarose cột spin (Supelco) hoặc một chiết QIAEXII kit gel (Qiagen). Endonuclease hạn chế tiêu hóa của DNA và nhân bản của tinh khiết mảnh hạn chế đã được thực hiện bằng cách sử dụng các thủ tục tiêu chuẩn (3). Sản phẩm PCR tinh khiết được nhân bản trực tiếp vào pCR2.1-TOPO vector (Invitrogen, Paisley, Vương quốc Anh) theo hướng dẫn của nhà sản xuất. Ligated DNAs được chuyển 18 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải vào vi khuẩn bằng electroporation (11, 16) bằng cách sử dụng một Gene Pulser bộ máy (Bio-Rad, Hemel Hempstead, Vương quốc Anh) đặt trong điều kiện 2 kV, 25 µF, Và 200Ώ (lĩnh vực thế mạnh, 10 kV cm-1) cho E. coli và 2,5 kV, 25µ F, và 400Ώ (lĩnh vực thế mạnh, 25 kV cm-1) cho P. multocida. Sau electroporation, Các tế bào được ủ trong trung canh cho 1 h trong trường hợp của E. coli và cho 3 h trong trường hợp của P. multocida trước khi aliquots(phần mẫu đại diện) của việc đình chỉ bào bị lây lan trên thích hợp kháng sinh chọn lọc thạch. Chia đã được thực hiện bởi giao phối tấm cuối-mũ-phát triển nền nuôi cấy giai đoạn như mô tả trước đây (5). Cho mục đích này, tự phát streptomycin chịu dẫn của cha mẹ P. multocida chủng bị cô lập và sử dụng như là người nhận để lựa chọn đối với các chủng E. coli được sử dụng như các nhà tài trợ. Xây dựng đột biến aroA của P. multocida chủng HS. Chuyển tiếp và đảo ngược mồi đã được thiết kế từ trình tự aroA của P. multocida serotype : 1 chuẩn PBA100 (14; GenBank nhập số Z14100). Các aroA gen của P. multocida chủng 85.020 và đã được khuếch đại bởi PCR là 1,2-amplimers KB bằng cách sử dụng chuyển tiếp AroA1 mồi (TTACTCTCAATCCCATCAGC; nucleotide 315-334) và mồi ngược AroA2 (ACAATGCGATTAAAGCAAAG; nucleotide 1495-1514). Các sản phẩm PCR được tinh khiết và nhân bản thành pCR2.1-TOPO. Đối với chuyển giao gen nhân bản để P. multocida, những mảnh aroA đã bị loại ra như BamHI / mảnh XhoI và nhân bản vào véc tơ tự tử pAKA19 cắt với các enzym như nhau. Một băng mã hóa kháng Kanamycin (KMR) đã được gỡ bỏ như một 1,24-KB PstI mảnh (nucleotide 421-1.661) từ plasmid pUC4K (Pharmacia) và chèn vào các gen aroA tại một NsiI độc đáo (nucleotide 718).alen trao đổi của KMR-gián đoạn gen aroA với gen bản địa tại các nhiễm sắc thể P. multocida đã đạt được những thành công với chủng 85.020 bởi electroporation và sự kết hợp với sự chủng Smr . Đối với các thủ tục cuối cùng, plasmid là lần đầu tiên được chuyển giao cho E. coli Pir SM10 bằng điện di. Nhân vi khuẩn đã nhận plasmid lên thạch máu BHI chứa đựng chỉ Kanamycin cho chủng 85.020 và Kanamycin cộng với streptomycin cho chủng SMr để chọn KMr và KMr SMr tao dòng, tương ứng. Đối với mỗi thử nghiệm, 50 thuộc địa duy nhất đã được chọn và sau đó cấy trên thạch máu BHI chứa Kanamycin cho 5 ngày để phục hồi các mất mát của plasmid pAKA19 và trao đổi các aroA, KMr chèn với gen aroA gốc vào người nhận nhiễm sắc thể. DNA nhiễm sắc thể sau đó đã được chuẩn bị từ ít nhất 20 đơn lặp lại của từng chủng và được kiểm tra bởi PCR bằng cách sử dụng AroA1 và AroA2 mồi. Bắt chước được JRMT1P. multocida cho chủng 85.020 và JRMT2 cho chủng SMr được chọn để nghiên cứu thêm. Bảng đáp ứng của chuột với gen đột biến aroA 19 SVTH:Phan Thị Anh Văn VACCINE PHÒNG BỆNH DO PASTEURELLA GVHD: PGS.TS.Nguyễn Ngọc Hải Các dẫn xuất aroA của P. multocida chủng B:2, là ứng cử viên cho vaccine nhược độc chống HS như sự an toàn và hiệu quả của các chủng đã được chúng minh trong mô hình chuột bị nhiễm trùng. Vaccine đã được thử nghiệm với một trong hai gia súc hoặc trâu hoặc bò. ***Tạo các miễn dịch trên chuột từ lông opmH hay opmA của pasteurella multicoda -Pasteurella multocida OmpA (PmOmpA) thuộc nhân tố chính và có quân hệ với Escherichia coli OmpA của protein. Chúng ta đã có những báo cáo trước đó rằng protein đã được nghiên cứu, gen miễn dịch và bám chặt bằng bắt giữ tế bào chủ và chất nền matrix của tế bao chủ (Dabo SM, Confer AW, Quijano-Blas RA. Molecular and immunological characterization of Pasteurella multocida serotype A:3 OmpA: evidence of its role in P. multocida interaction with extracellular matrix molecules. Microb Pathog 2003;35(4):147– 157). Trong nghiên cứu này , chúng ta thấy , hệ thống miễn dịch của chuột với PmOmpA tái tổ hợp từ đáp ứng miễn dịch từ Th2-type, đặc tính này gây ra bởi sự sản xuất kháng thể immunoglobulin G1 (IgG1) Hay một nghiên cứu khác, tạo đáp ứng miễn dịch bảo vệ tế bào từ lông opmH, là nhân tố vận chuyển ion Fe qua màng. Các nhà khoa học nghiên cứu tạo ra chủng đột biến gen opmH và thủ nghiệm trên chuột. Và đây là hướng mới phát triển vaccine Các vi khuẩn và plasmid sử dụng trong nghiên cứu này 20 SVTH:Phan Thị Anh Văn
- Xem thêm -