Isolation and selection of thermal - tolerant toluene degrading bacteria

  • Số trang: 25 |
  • Loại file: PDF |
  • Lượt xem: 17 |
  • Lượt tải: 0
minhtuan

Đã đăng 15929 tài liệu

Mô tả:

MINISTRY OF EDUCATION & TRAINING CAN THO UNIVERSITY BIOTECHNOLOGY RESEARCH & DEVELOPMENT INSTITUTE SUMMARY BACHELOR OF SCIENCE THESIS IN BIOTECHNOLOGY ISOLATION AND SELECTION OF THERMAL TOLERANT TOLUENE DEGRADING BACTERIA SUPERVISOR Dr. NGUYEN HUU HIEP STUDENT VO NGOC THAO NGUYEN Student code: 3082615 Session: 34 (2008-2013) Can Tho, 2013 APPROVAL SUPPERVISOR Dr.NGUYEN HUU HIEP STUDENT VO NGOC THAO NGUYEN Can Tho, May , 2013 PRESIDENT OF EXAMINATION COMMITTEE Abstract Nowadays, the development of industry offers people a better life. However, industrialization without caring about the environment may lead to negative effects on the Earth as well as human health. Therefore, the contamination of Toluene, an organic solvent which is a common ingredient in painting and leathering industry, has caught many attentions of scientists. The aim of this research is to isolate and select thermal-tolerant bacterial strains which are able to degrade Toluene. Soil samples from four Toluene-contaminated sites in Can Tho city were incubated with Toluene in both gas and liquid phase to increase bacterial mass. MSB (mineral salt basal) medium was used for the isolation of these bacteria. Isolated bacteria which were able to use Toluene as a sole carbon source and synthesize enzyme amylase, cellulase, lipase and protease were selected to identify at molecular level. Moreover, drop count method was used to examine the ability of degrade Toluene of bacteria. From four soil sources, 09 bacterial strains were isolated. Most isolated bacteria could produce enzyme amylase, cellulase, lipase and protease. T14, T38 and T50 strains were selected for 16S rRNA analysis and on the basis of 16S rRNA, they were assigned to Bacillus licheniformis, Bacillus subtilis, Acinetobacter sp, respectively. T38 (Bacillus subtilis) could use Toluene as a sole carbon source at 1% and 1.5%. Key words: Bacteria, degradation, isolation, organic solvents, Toluene contamination. i CONTENTS ABSTRACT……………………………………………….........i CONTENTS..………………………..……………...…….........ii 1. INTRODUCTION ..................................................................... 1 2. MATERIALS AND METHODS .............................................. 2 2.1. Materials............................................................................. 2 2.2. Methods .............................................................................. 2 2.2.1. Isolation of bacteria ..................................................... 2 2.2.2 Study of the ability to degrade Toluene ....................... 2 2.2.3. Study of the ability to produce some enzymes ............ 3 3. RESULTS AND DISCUSSIONS ............................................. 4 3.1. Result of isolation of thermal-tolerant Toluene degrading bacteria............................................................................... 4 3.2. Result of study of the ability to degrade Toluene .............. 5 3.3. Result of the ability to produce enzymes of isolated strains ........................................................................................... 7 3.4. Result of identification of selected bacterial strains at molecular level................................................................. 12 3.5. Result of experiment proving ability to degrade Toluene of selected bacterial strains .................................................. 17 4. CONCLUSIONS AND SUGGESTIONS ............................... 19 4.1. Conclusions ...................................................................... 19 4.2. Suggestions ...................................................................... 19 REFERENCES ............................................................................ 20 ii 1. INTRODUCTION The development of industry offers human being a better life. However, it cannot be denied that industrializing without caring about protecting the environment may bring serious environmental hazards. Especially, toxic chemical like Toluene, an organic solvent discarded from manufacture processes, could directly affect to human health as well as ecosystem (Lau, 2011). Among many traditional methods used to treat organic contamination, bioremediation appears as an outstanding method because it does not cost much and eco-friendly. Therefore, scientists around the world have been interested in figuring out bacteria that have ability to degrade organic solvents. Vietnam with an abundant bacterial population will be a promising site for isolating potential Toluene degrading bacterial strains. Objectives To isolate and select thermal-tolerant Toluene-degrading bacteria. 1 2. MATERIALS AND METHODS 2.1. Materials Soil sample from four potential sites in exposuring to Toluene in Can Tho city Medium: MSB (mineral salt basal) medium (Na et al., 2005) : K2HPO4 : 4.5 g/l, KH2PO4 : 3.4 g/l, (NH4)2SO4 : 2 g/l, MgCl2.6H2O : 0.34 g/l, MnCl2.4H2O : 0.1 g, FeSO4 : 0.6 g, CaCl2.2H2O : 2.6 g, Na2MoO4 : 0.02 g, ZnCl2.7H2O : 0.01 g, CoCl2.6H2O : 0.01 g, CuSO4 : 0.01 g, NiSO4.6H2O : 0.001 g, NaSeO4 : 0,001 g per liter of deionized water Chemicals and equipments in Microbiology laboratory 2.2. Methods 2.2.1. Isolation of bacteria Collected samples from 04 different sites were incubated with Toluene in both liquid and gas phases in 2 weeks. Then the samples were diluted into various concentrations and spread on sterilized MSB agar medium. Then they were incubated at 48oC with Toluene in gas phase. When colonies formed, colonies with different characteristics were subcultured until achieving single colonies with identical shape and size. Colonies were then examined under microscope to determine the purity of bacteria. Isolated bacteria and their colonies were observed their shape, size and Gram characteristics. 2.2.2 Study of the ability to degrade Toluene Isolated bacteria, in this experiment, were studied in order to generally estimate their capability to utilize Toluene as a 2 carbon sources. The main principle to determine degrading Toluene capability was comparing the change of optical density of MSB liquid media containing Toluene at 0%, 1%, 1.5%, 2% of different bacterial strains after 0, 2, 4 day. One percentage of bacteria were cultured in MSB liquid media containing Toluene and incubated at 45oC, shaking at 120 rpm. 2.2.3. Study of the ability to produce some enzymes *Enzyme protease Principle: 5 µl of bacteria nourished in Luria Bertani was dripped on MSB agar containing skim milk (2%). The diameter of Halo around the colony was measured to determine the ability to produce enzyme protease. *Enzyme lipase Bacteria were cultured in MSB liquid media containing 2% of oil to observe the ability to produce enzyme lipase. The parameter used in this experiment was optical density of bacteria at the wavelength of 600 nm. *Enzyme amylase Similar to enzyme protease, halo diameter in MSB agar media containing 2% starch was used as a parameter to examine the ability to produce enzyme amylase. *Enzyme cellulase MSB agar media containing CMC (2%) was used to determine the ability to produce cellulase of bacteria. After dying with Iodine, the diameter of halo around colony would show the ability of bacteria to produce enzyme cellulase. 3 2.2.4. Identification of selected bacterial strains at molecular level Based on the result of the ability to degrade Toluene and produce enzyme, three strains were selected for the identification by molecular technique at Biological Molecular Laboratory of Biotechnology Research and Development institute, Can Tho University. 2.2.5. Experiment proving the ability of bacteria to degrade Toluene The experiment was carried out with 4 treatments, 3 replicates, completely randomized design. Four treatments consisted of MSB liquid media containing Toluene at 0%, 1%, 1.5%, 2%. Bacteria were inoculated in each treatment and incubated at 45oC, shaking 120 rpm. Drop count method was used to determine bacterial density in each treatment after 0, 2, 4, 6 days. 3. RESULTS AND DISCUSSIONS 3.1. Result of isolation of thermal-tolerant Toluene degrading bacteria From 04 soil samples, 09 bacterial strains which were capable of degrading Toluene were isolated. Among these, there were 07 strains isolated from Tay Do leather factory and 02 strains isolated from Xang Thoi lake. All bacteria had rod shape. Colonies on MSB agar media were circular or irregular, entire and undulate edge with raised and flat elevation. Colors of colonies were milky white except T4 with clear white. The growth of these bacteria was quite slow (from 48-72 hours). Gram 4 staining showed that all bacteria were Gram negative. Matsumoto et al. (2002) also reported that genus Pseudomonas Gram negative could degrade organic solvent. Figure 3. Characteristics of some bacterial colonies 5 T12 T38 Figure 4. Gram staining of some bacteria 3.2. Result of study of the ability to degrade Toluene Isolates were observed their growth in media with Toluene as a sole carbon source. After two days of incubation, almost all bacterial strains decreased their growth. The reason for this might be explained that the changing of environment made bacteria die. We found a different pattern among bacterial strains after four days. Besides strains that had OD decrease such as T3, T4 strain, the other bacterial strains grew differently at different concentration. This meant that the ability of bacteria to adapt to Toluene concentration was not the same among bacterial strains. For example, T38 strain, at 1% of Toluene could increase gradually but at 2%, its growth decreased. This might be because T38 strain was only able to use Toluene at low concentration. If the concentration was high, it became toxin to the bacteria. Previous results also reported that some bacteria which could degrade organic solvent but they could only survive when organic 6 solvent concentration was lower than 0.3% (Moriya and Horikoshi, 1993). Note: OD(600nm) Time Figure 5. Optical density of bacterial strains through days T14 and T50 strains had different growing pattern because their OD increased in day 2 and decreased in day 4 at the concentration of 2% (Figure 1). Maybe, these two strains could adapt quickly and used Toluene as a carbon source to grow. The decrease might be caused by the inhibition among bacteria. According to Sardessai and Bhosle (2002), some bacteria belonging to genus Bacillus were able to use Toluene as a sole carbon at 90% of Toluene. The results showed that T14, T38 and T50 were promising strains in degrading Toluene. 3.3. Result of the ability to produce enzymes of isolated strains *Enzyme protease 7 06 out of 09 strains were able to produce enzyme protease. Among these. T14, T9, T50 and T51 strains had significantly large diameter comparing to T3 and T34 strains. T4, T12 and T38 strains did not produce enzyme protease (Table 8). Table 8. Ability to produce enzyme protease of isolated bacterial strains No. Bacterial strain Halo diameter (cm) 01 T3 0.5c 02 T4 0d 03 T9 1.2ab 04 T12 0d 05 T14 1.3ab 06 T34 0.3c 07 T38 0d 08 T50 1.1b 09 T51 1.4c (Note: F= 54.42, means followed by the same letters in the same column were not significantly different (P<0.05)) *Enzyme lipase All bacterial strains but T51 had OD increasing in day 2 and decreasing in day 4 which proved that bacteria grew quickly in day 2 and decreased in day 4 (Table 2). T51 strain did not produce enzyme lipase because its OD decreased overtime. Comparing the change between day 0 and day 2, we selected T38 8 as the best source of producing lipase which had the growth significantly higher than others. Table 9. Ability to produce enzyme lipase of isolated bacterial strain No. Bacterial strain OD (600nm) 01 T3 0.168b 02 T4 0.064c 03 T9 0.143b 04 T12 0.042cd 05 T14 0.189b 06 T34 0.135b 07 T38 0.274a 08 T50 0d 09 T51 0.153b (Note: F= 15.31 , means followed by the same letters in the same column were not significantly different (P<0.05)) *Amylase After dying with Iodine, all strains could form halo around the colony. T4, T38 and T12 strains formed significantly larger halo than others. T9 strain formed the smallest halo. 9 Table 10. The ability to produce enzyme amylase of bacterial strain No. Bacterial strain Halo diameter (cm) 01 T3 0.5f 02 T4 2.8a 03 T9 0.2g 04 T12 1.6b 05 T14 1.2c 06 T34 0.6f 07 T38 1.8b 08 T50 0.9d 09 T51 0.6e (Note: F= 78.36, means followed by the same letters in the same column were not significantly different (P<0.05)) *Enzyme cellulase All bacterial strains could produce cellulase (Table 4). T50, T4 and T12 produce the largest halo. 10 Table 11. The ability to produce cellulase of isolated bacterial strains No. Bacterial strains Halo diameter (cm) 01 T3 1.5c 02 T4 2.4a 03 T9 0.9d 04 T12 2,5a 05 T14 0.9c 06 T34 0.8de 07 T38 0.4f 08 T50 1.95b 09 T51 0.6ef (Note: F= 98.88, means followed by the same letters in the same column were not significantly different (P<0.05) The result of enzyme test on the ability to produce enzyme protease, lipase, amylase and cellulase showed that almost all bacterial strains could produce these enzymes. These results were in agreement with previous studies on organic solvent degrading bacteria (Ogino et al., 1995; Rahman et al., 2010; Trivedi et al., 2011; Pandey, 2012). Ogino et al. (1995) reported that Pseudomonas aeruginosa could synthesize protease which was stable in organic solvents. Moreover, the ability to produce enzyme lipase of organic solvent degrading bacteria, Pseudomonas sp. and Bacillus sp. were also recorded (Rahman et al., 2010). Bacillus aquimaris could also produce enzyme 11 cellulase stable in organic solvents (Trivedi et al., 2011). According to Pandey (2012), Bacillus agaradhaerens was able to synthesize enzyme α-amylase at 30% of organic solvent. In summary, the results from enzymes tests reflected that T14, T38 and T50 strains were promising strains in degrading Toluene and producing some enzymes. Figure 5. Halo created on starch and CMC medium by bacterial strains 12 3.4. Result of identification of selected bacterial strains at molecular level Three strains T14, T38, T50 were identified based on 16S rRNA gene sequencing. Using BLAST search tool for analysis of these isolates. The results showed that T14 strain had 99% 16S rRNA sequence similarity with Bacillus licheniformis strain W11 and T38 strain had 89% similarity with Bacillus subtillus BSn5. Whereas, T50 strain showed 85% homology with the sequence of Acinetobacter sp.G16(2009). *16s rRNA gene sequence of T14 strain (995 nucleotides) TCGAGCGGACGACGGGAGCTTGCTCCCTTAGGTCA GCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTG TAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACC GGATGCTTGATTGAACCGCATGGTTCAATCATAAAAGG TGGCTTTTAGCTACCACTTACAGATGGACCCGCGGCGCA TTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGACG ATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGG GACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAG TAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGC AACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAAA CTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGG GCGGTACCTTGACGGTACCTAACCAGAAAGCCACGGCT AACTACGTGCCAGCAGCCGCGGTAATACGTAGGTGGCA AGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAG GCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAAC CGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAG AAGAGGAGAGTGGAATTCCACGTGAGCGGTGAAATGCG 13 TAGAGATGTGGAGGAACACCAGTGGCGAAGGCGACTCT CTGGTCTGTAACTGACGCTGAGGCGCGAAAGCGTGGGG AGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTA AACGATGAGTGCTAAGTGTTAGAGGGTTTCCGCCCTTTA GTGCTGCAGCAAACGCATTAAGCACTCCGCCTGGGGAG TACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGG GCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAG CAACGCGAAGAACCTTACCAGGTCTTGACATCCTCTGA CAACCCTAGAGATAGGGCCTTCC The sequence was identical to Bacillus licheniformis at 99%. Strain T14 was a potential strain in degrading not only organic solvents but also crude oil (Das and Chandran, 2010; Reda and Ashraf, 2010). According to Das and Chandran (2010), Bacillus licheniformis which was isolated from polluted stream could degrade crude oil. Moreover, Reda and Ashraf (2010) also reported that Bacillus licheniformis was potential in degrading Toluene. *16s rRNA gene sequence of T38 train (784 nucleotides): TCACCGGGGAGCTAAATGCAGTCGAGCGGAAGAG GGAGCTTGCTCCCTGTATGTTAGCGGCGGACGGGTGAG TAAGACGTGGGAAACCTGCCTGTAAGACTGGGATAACT CCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAAC CGCATGGTTCAAACATAAAAGGTGGCTTTTGCTATCTCT TTTAGATGGACCCCCCGCGCATTTGCTAGTTGGGGAGG GAAAGGCTCCCCCAAGGAACGATGCGGAGCCGACCTGA GAGGGGGATCGGCCCCACTGGGGGTGAGAAACCGGCC AGACTCCTACGGGGGGGAGCAGTGGGGAATCTTCCCCA 14 ATGGGCGAAAGTCTGACCGAGCGACCCCCCGTGGGTGA TGAAAGGTTTTGGATCTTAAAGCTCTGTTGTTAGGGGAG AACAAATACCGTTCGAATAGGGCGGGACCTTGACGGGA CCCAACCAGAAAGCCCCGGCTAACTACCTGCCCACCAC CCCGGGAATACGTAAGGGGGAAGGGTTTTCCGGAATTT TTGGGCGTAAAGGGCTCGCAGGGGGTTTTTTTAATTTGA TGTGAAAACCCCCGGCTCCACCCGGGAGGGTCATTGGA AACTGGGGAACTTTAGTGGAAAAAAAGAAAGTGGAATT TCCCCTGTAGCGGTGAAATGGGTAAAGATGTGGAGGAA CACCCGTGGCCAAAGGGACTTTTTGGGCTGTAACTGAC ACTGAAGAGCGAAAACGTGGGGAGCGAACAGGATTTA ATACCCTGGGTAT T38 was identified as Bacillus subtilis at the identical level of 89%. Although Bacillus subtilis was reported to be unable to grow in the presence of organic solvents at concentration of 10% (Abe et al. (1995). Recently study of Navacharoen and Vangnai (2011) proved that Bacillus subtilis could use diethyl phthalate as a sole carbon source. In addition, Bacillus subtilis also had the ability to degrade crude oil (Das and Chandran, 2010) and Dimethylformamide (Vidhya and Thatheyus, 2013). *16s rRNA gene sequence of T50 strain (957 nucleotides): CGGTGGGCCGGCCAAAAATGCAGTCGAGCGGGCG AGGTTGCTTCTGTTCTGAGCTAGCGGCGGAGGGTGAGT AATGAATAGGAATCTGCCTATTATGGGGGGAGGCATTC CTTAAGGGAAGCTAATACCACATACGTCCTACTGGAGA AAGCCAGGGCTCATTATGAACTTGCGCTAATAGATGAC CCTTACTCAGATTCCCTAGGTGGTGGGGTTAAGGGCTAC 15 CAAGGCGACTATCTGTAGCGGGTCTGAGAGGATGATCC GACAGGGTGGGACTGAAACACGGGCCAGACTCCTACCG GAGGCTCCTACGGGGAATATTGGACAATGGGCGGAACC CTGATCCAACCATGCCACGGGTGTGAAGAACGTCTTTTG GGTGTGAATTACTTTAAGAGAGGAGGAGGGTTACCTGA GAAATACCTGGGCTAAGTGGACGTTACCCACAAAATAA CCACCGGCTAACTCTGTGCCAAACTCCGCGGTAATACA GAGGGTGCGAGCGTTAATCGGATTTACTGGGCGAAAAG CGCGCGTAGGTGGTTAATTAAGTCAAATCTTAAATCCCC GAGCTTAACTTGGGAATTGCATTTGGAACTGGTTGGAA ACTGTATGGGAGAGGATGGTAGAATTCCAGGTGTAATT CCACAAATGCCTATAAAATTGGAAGAATTCCGAAGGAA CACGCATGCCTCTGGCCTAATTCTGACCCTTAAGTGACA CTGAATGGGGAGCACACAGGAATAAAAACCGAGGAAA TACATGGCGTAAACAATGCCTACTAGACGATTGCTGATT GGAACATGTAGTCCGCCCTCTAACGCTGATAAGTAAAC CATCTGGACAGTACCGTGCGCAAGTACTAACTCAGACT GAAATGACAGGGGCTCGCACGAGCCCCGCACCATGTGG TTTAACATCGTATGTTTACGTCAAAACCACTGACGCTAG GAACTT After being aligned using BLAST, T50 strain was identified as Acinetobacter sp. at the identity of 85%. Acinetobacter genera was known as a potential bacteria in degrading carbonhydrate which could remove up to 70% of medium chain alkanes (Malatova, 2005). Walker et al. (1976) isolated Acinetobacter species from oil-contaminated water and sediment in which they could yield significant greater degradation 16
- Xem thêm -